%PDF-1.4 % 1 0 obj <>/FirstChar 255/Type/Font/BaseFont/Helvetica-Bold/Subtype/Type1/LastChar 255/Widths[0]>> endobj 2 0 obj <>stream x+r ҏ4V045PI2г414P@ҁR@ C33s]*nlb`bd˥T (- endstream endobj 3 0 obj <>stream x+r ҏ4S045PI2г414P@ҁR@ C33s]*nlb`bd˥T (0 endstream endobj 4 0 obj <>stream x+r ҏ4T045PI2г414P@ҁR@ C33s]*nlb`bd˥T (+ endstream endobj 5 0 obj <>stream x+r ҏ4U045PI2г414P@ҁR@ C33s]*nlb`bd˥T (Q/ endstream endobj 6 0 obj <>stream x+r ҏ4W045PI2г414P@ҁR@ C33s]*nlb`bd˥T (1 endstream endobj 7 0 obj <>stream x+r ҏ4R045PI2г414P@ҁR@ C33s]*nlb`bd˥T (, endstream endobj 8 0 obj <>stream x+r ҏ4Q045PI2г414P@ҁR@ C33s]*nlb`bd˥T (. endstream endobj 9 0 obj <>stream x+r ҏ4P045PI2г414P@ҁR@ C33s]*nlb`bd˥T (N* endstream endobj 10 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI]>>/Type/XObject/Filter/FlateDecode/Length 39/Matrix[1 0 0 1 0 0]>>stream xs w3RPI2T0B˥ [ endstream endobj 12 0 obj <> endobj 15 0 obj <>stream xPU *)"%( JIJt( X !*)y8F@ngޙ{glev5zʗW^ǽxk[?E,9|׎o5?2m߿R',KZq5Z5ZڻttW^yNyI a5 ﯝ4j4Ty[|ԂbK7UVo67mkkgnÜcr5-sW'>]~m`AQ;wچX醯#KR؛.힉M3؟Կw`ǒRMI;~%'G~fkD=p,xe!HPV2Yzl\ºr[URuQ NAԡ6PxlA]FZ{YJ,QhOX>DN >։$RBmbE[}jxдٿv}Ӱ˽;x/fpȉQSASǧϝ2c5u<nK\ʻ[ڷ܍w#'Fˑ_sts 7;䢜x)Lz|J峪5[?h8a=7(]#&{ Gw(a˸ZIxr>GINH%3 JjqfVL[GN>8ԃ[088x|H0<=ar%˜Xް⸆w1-v*y]t=[7;W묾k~Q1$tm3źc,ד7\oتɺt65MͩKvY[tI2u7U&H'g Wf?u0;.'<7 +߱1+(|_vɥ'DGBTɨWjcp&$ ;OE#Ř, I rݛ<²9Gea(KKO>k)"su [[w:C]wn  73utƩ5HM9q.BOCL][y}  xOO=xyywq?~X%?;gؿe+Lfpul9lٹ1_gJ.,5/ ;p{ [Bj W'CCcýw9U2T~j6AZ`2>[G;MS7-:3#*~| 1&E [ = YQaYސ^Xݏ@wE;n-P1d\i5` e<||w$dqķǥ!T] @omJ ANr+o)`{kD --IڀVY"pW ^\{[[@2E@t=u[T; N #>=ѷwf po]R%PJ$ޗt9K  Ͳ (?Oowl}M$H`d[۸b/pn ij%>/fY`d./4 dom99S ݛ)Dj@b{D6l"vw }y3v ~y]ҍLEMoQ4 {0"9G#H?f$91=ʈ?&wt (%na?_ ;`oF٘/p76\&  }vi{2‰ ́Oӝiꮲ?p/2+=jvPqր3] +~x_"k'&x-n8E ­hWބ)` DqHm&QM~A=xkDlx\^i _#`m,+0/n_j̀5}X 2>K@ .h+<=ъ ~=Y:'whx_@byȽl oj9{g8 1 iB\JeCFb`{>Fġs.C^zGO60alo[(jհ)YRlX ԺCDG Ďk/<\rϰTL׬hh jYk@r")N]X`*xMdXΥ64g&I+<J+H{xBHVKx%Ju-lJ=z̦4\%}\$MB o EiZBa@D`\h% h7XBra؊:t 0Dq.,DYԉIE@2bqU3:*B>)##t—?lpL56 Tᘅpt'v$#lu˕\@!c{]:sfl@:3vcf0hhRA4 @\w]L]7ڃ܈ͺGf9SuB< & )Dbf C(?4rqde=H6%Y›+Ozb/5>'1H zW;ؿ$2!W>.T.!nЍ:M}~=ބRPѩ<.HPP<+tt.$#l-S}Q A/ӯjn" ȽhC(:Z~ 61'"|[8߅Wp)1wOR9՘/$ý1Fx.y}sr>5DL+p#S͵K&p3;J0sH'4y$x OQ PNGx̹6!t1R ܀Bx9Yb :#n IWǫ1/Jށ4 ^$F`Ap"f:l@0c5ҥAv z0ՙ$˩r}QjP}F\UuՈl xR/E QJ\Jr S="o?ZQ͙}cpYEqFֻ!-CPn&Uk Ѧv (դ0YSҥrs1>}?s[I׊PF9]I: B\a|gɘ\YNI743?K⢇TGd%rϮ"}%~n#XeMĭˌPDqYR@U rM/~S $B|ݘm{$uރZ` %M5&km0l`k&BϨ`yoHk+wG-qKԂ$]dx5Ā4cǷSVbž1(B`kfnkڲz9z9(w.cET2V'˨Ϛ!_SRɉ/֒[ pBmf UEx7tU`qz9c"SV#Hڣ)ā :ݭ+qRo[?qձKzMF,~t4fZ7^p O&ImvQ S~c{r59HxhkÚo5r+YH^` 0:NRƜ{F+~T4i'%Cv: [@4ސk|P5bw$әyQX";@y ?c܊دG!" 8ԭ#m`2N\ f\ cypхVDޣ塃}Qumz+щzXVWH6 r|ג&?&|>pƿ >9KK!pzW(so.DTl0?yj5GBeL/һ(I-B#M.JĶ:H5Ӣ]f->rLJ됋e6^'3(h}Iw6mUiNfypI9ɨuPxBaۢs7iO TԴ1'4Ӿ~uuޑJXKD,or}6]Nd:싡х?7QvmSI+97"1W§u<jX\o[3qgr1vJD c^-J& V'v :7O7bF( ld+\3?]~ZFceg %}*¬^|ՍΈ'& o[HN +ƇCAغ}&G.1w%UPoCGW ѩFޚ3~oo; R j h=OH%0l Btۅz7<}[!r+ch-GxĶ#<^n!+Hl` [O!l}x |FGuQ W7mLj7(u(9LWa1cY$HC7$jpcCֱh=| Z%K$@IN6Ej*>5Mq< Iu'cDKm=ٜkBÐ^jɣt{I2FE/HFNrSyOQFx?@]pBniDJ'h|KՉ8@hꔪb3i^bd^Kc V1i1Ucԍ` YUT^+֭%$񵟁B3a!R6w~c XVhW屦{ʀfOQ. 0'iW=(̮mM[y%ٮ3;0bxnTN1r Cg+|2N>i_Riڐ57%c'iV R]iOnTW>r?1sRo Χ)b G]i<E zOU$t:mmyZU6ŮZ7n!$(Bo.W1uW89'1S/q~T_0э9[n$ҏ;yQ'ɍuT W(7Hg>$V Ă;{e ЮraXOHAσj3nt\F $f+a-Tm ~W$? ~'0[8vm7ҷV7Xa=,<*}Tqtd,@d Poأ?oI(WrJҲYtEy)_"J1߄bf%W f⶙_b(4[&8Uae* /Qc*$s0H2 u\d8[M>`?\`54d<^ѷrW XzT-I2Nկۼd_a)GDc}&-F u8,&Q`nEݢHt [_ m{eeϲx ѶU[;9N lvWןZ@wI7 ?Jc~6fuOoa|y{ 1Jd d lWP:quuX72k7"r;)~onpf\4H0n]ĤVE0QgpEb7i/T$hullhQpa& _[n~h~xУ k~9,jU&($yx/JB У&|)S32}9PݱIma7GᎲz8:w1G 4YUoq~!`YtLx1=[o. };nH y4:w㡵 c GQRʪÝ/H}Z} OuXdر21oMsવiPO&C4F1NKT:!F)LGlk+$EcyxrM{t9}_je[Q̀>'싸LCHxmm/>9FQj%UYS­i= wέ$]rFk6MdA)Gɹ`W6޽ʥʱWxDsnm] k+9QX]rS$p9R5j:tGr*u_6-/0l6TRw+Ɋx|s-:+#1q;sp♁ԗ:IV3rp@󼧪"_t~hRhEv~1$X,otڛ_CM1@b=fuq}!Avdw&z׳C{P1;(eLAi#sI'YMxJ=AlYhN3g<4RAJ=RЭK/ xފ,t߅p(iof;k u%1J]\lҔFNZo5"5 øߠcŸ %'Yzځ# I̯ 1G%&Ac!'qo Б qfSYO&m M1Mf| @͂8oGpgqDáoGYZ4޶jXL~c9&p>y{C-'RHk}74=i;$X xd-zؿAwuI[{Wbqh-!5e-wبFPX:'͈ZtBIi/=z!PXs1̻6/>Kd -Si9S B@t=p_WȔuHE`-eIBb#{dg^g5R纓1Zhm TiC‚L΄z}kZ;-Tрkr%*h?p&2uʦVM.K}m:>6mkE]Tޫ{ɰi&->`~O>AO0p8Ϭq8Cߛьk+@6w}q4n߁kb]Hb42{I^V;ܚ[7yMy3 UvBD~hc"d{p3qb98 )[}#?7s(n"6^?#"r d pWq e6|u @)[w/n&f+v(r+n47x;i0 O/A81\!me?JA 'RJPq&nw*t{G2/serSt 4R|W*E &-׈M j*"S瓣,efq>i;5>0gY~npl|;0.S2#oSc=zӴs^a E2=d1h_r%eYL?8Ϊ1d͞O#˃jگ#6'[df.-h,%9j`BҶq:Qa+lH/sRrZ-a'x^?}[dP1஘ܭBȂCJZH7~PN9YO-%+Y5"RIBjuwOk7Вt.uexHBKR"}"|*`=Y!k^3'L轖m: ?-nwx'Io//1q@ٴJW{ G k$FM.v>` > `*q.TxB g!<}@ T}M`%pFD# j@meI8 q, f#b gfS5jSwN.ap=oKp>bl"$ D GAQVT޺\Sƾ0-yDt݀  !/H;2Ah5c1߸V;oWKN>_!gl+͜8 \ALQ/I<5@l+qUujM՟S:ꟵY5 LU_P/͑р˙ QQ'M@eδhRSwUNU[ [ի|e5xhiH0y:0RI3*UWpUU&<ڦ˨%5TWGd4[0?ܢ>d:λV>;R;?Xk 2zf*9A u_{S۟jUf_MQ5W/^k U埕^LW3YE{RjZ-"kJ;f@bd:_}f|7V}ć AD'Ȭt MsW5pGH1U 4 ">fx/E5¦)NL5 {0<V/7k]nâaFN#L{ }+>}wH z΢`zP.a]r!ʆVӏ6D@R t+E@A)[s۠8Get "U?/.(; b4Bf,ëpI[lQR,vR+"!<2:qݛ47@g@XBdA>#wF2D[Z~9bv:qaC@i]= t%1>?f_!dcXXL3dU|0Cp3$D^eY`\ @n$V坵gVoEWT(]7ۂ\:p  YDγ[} oȍX;pN? "{)=LOO#*V?6b;!)HSxukϩtj܏;N6 Pnbʁ(6tҾd0DMTS721 A"ǯ&`w1cm:f5"I7j|$Bm$ʐ(▼q.^\>t 38L"z_zU{6H4WxG"I=sq|ٲO&®b.KF{˦[U#4R!d?#5x):;#\NSc`EB.=f1uɱ% r:%5ڀX.~ĉ:L-iC4v ]H^? qq{]ϭtdl{v5ǵزzex2KŸ?.ڃ *mls]Q=h(Ԃh~A~^y{yoNG<<)BNmCj' վ3x9U;!B˵WvLJ.Pիd OġC|> <zЅK 8d|m6ܨKCrgI8LaZVC qX3 vbt`R16 R)kab3 stȉ۸רGtPm(F9lTf@(Wi-}s(cwMrk #s&q`ܧ$-t51AQ\zIMub ¸]/+mvQ`z8'y?H߆NP3xnG-u$m(t Dx/-adј5轴(ebJ Ym-zC>$$S)tcQX>X sYBnEexڝGn)VG <]Ns"ݭF0k^KQA ExB*HB׈6Bx/"W;B]]%O&/oCIS׻^Pm4lL'4uێul;p2Ai09k̋tg:m6*ٍ Wc;5J= ݂|)-Zs?>X %z:.jN\1c,.WL"ę@c{ώW[]@յ:Č"[#euv:p1zw ŸoFVr"ַRj$Cu$]ơ( XM^B߁[A$8Cn hD>D iI EAZ ( TWuhHL31Jܚ}9oK_eӀ;r;15-G9y"DAaT* rP~KGfg 7}Y°HA>g2Ьb;5$KbM@9fFv- Jpk `  S?)tU!&-g#⿠?b#,-{L)TQKb\K4!x9q+\4zY@cٽR/&IDQ@nJo I.L߃#7~ 5&޴#'z:`ҔGe˰TWbJrp]~" A+?{& 7&+7a f(<ה>TDiܫCT7 a\ ; 4ëMȌئ4~{ A6Wns <]z7"ZIhE?uLiyy(KTKR\!޴;<KSzx7a47m (<7I_0ƿ蚓UT(%*O 2US^8jsjcIߔ u69LqX0^^#NO3+(WWEur$8s7dp_&.Z .X`0B1>(,>1|M(r}b9 eнJD!֒ Չ3HJu<Dr^zS8JH_H\A]cg50tpIIKXzh;EԳ)ApVzΠK|Y$ ;3zM=daQ8Gӡm"Pk20H?'TOd4_Sse#8%,Ot]c"v0MVt{|#:ˬ$YR vE\SGmT.* -F}GyANl q*&B/}Iu[Y5-Dї$?c]{0ҐU]=Q~N9ɇs !֪FOG=-}Fm"k Eo)bէf4Sˮ'ȏ$B/k* wmQ+z |C uVZBcE`W꠪7A,T<'j7+{MS=:J*EYx~9u0ٯy*Zׁ*ZJVB՛5@\xY `Ib]ɐiC< 4}r{Zf44εn }ޚf#]EbT@9ajȳ5b1 u,ABnIƽԎ[ͶC,u/ \^NlA&Y֌b AKtor"PO݊m]b` 631DU'HfXǛp5"+Pc&0yZFՄhn_FfBpZI9tt"!eWZ'_SuNFuQRyYxϿ82 aR@J%;Z#`r{z\CC.JbeB 9ߔ穥8bG̑41Ke'm kܕ?8D;)PJDIX".JK#ތi_@!m+GE|bU7+jvQGdևMɚ'Ji.E}{}uq\zGt!pYw"Y?rUڻn+{LsߘБuB Z^OKk}a +l{2QMїysp_.K<HIdzѩvvV4B+s*2ٕr{oI5DĶ[ֳg@,Xc?,* ƏtZOت4.83k\|j6'Ftl+ROXo63'a4_QW7Ys:*[eXC;!j#6##Ĩc+ ̙KF"3 ͚Ϡ*KE.HtطRDZD:0ҭ(L#)y10*jRJ l?ݛ4TI+z%N쐦{Vck6q?7kպ@CG۴yqiM\M`Қm^d-`n;[.J.6GvP&jBG;_rbaM`1[{kV1@/,}5>"ВXiIV=Yu!h'*_h㑺5Ge;I%#3Pⴠ(<õfE9g2JVTM dekp}qs[U^ɒR24Ӳv]r% /i='8ICĝl`ˮZe[1ڦ,1D}neX*S$i4:,bI1;f-/FQ~ S'U 8*}i@ޚǞ?8ST?ˌt fc4N6vBa\L@]Y_q#\ŢuAfMZy*@$v [M18|uKn'z4<;6ˇۑ|pp*?N\"ޙ+CռXuP|wXڟY8L#fXOFގDlD5S+qrN=%Ĝ~a*r拼Ldz NyKN~=}8H9P?잖H0M^NLnk.. E(!bJ HI7Lי8  %Rvwwwק/ߋs"@&tPlzr׶tdqԅa-nӍ]A̢j2Cb^dQ+< F0 ^Kk?m/P?w]+w0#A#Wp%ER,| +&4uզ:yFoi{ڰax|g[43YU-P"{s 7g1)z@Ir}uECꚏgmlT4֎(% eb/A G?kLv~jKC{u qxmQQ !eH&[3O~ V 39q 5CTJ_T'.OϾKLN7Gz<[-7ts$u@?֖cT7di5_4Fsen)-'j\ExO< ,whA635N6i770't`LcĶvct؏'[wqe-&{Acs@=~7UI&<1c &+@;X"HiR~ieX{;m}?}0dݬ[F*YU5Zd(@<.5ddB%\h7wЖ$ն=2ctTԆ5o6r|{ ]^Cd*6 y#,rNvl|Yc ѻL`D,t`$ڜMrzH9xx?Y}Yۺ\|.[-:nMNNcs 쥹sfQR~'d0UW yS+\$ d6G ¼7cE+E\4 cv jם^{RlESY|f U>a+}X;$I^]_$?'g>0`oc- u!C#MϊLӾ=+[kFH*Cn*oٌtb Z܇+8t;P~s}o Mgv[ F ʹ4]^ϔ# /M1zsQnZG/ypߪ퐄ƽ-uQMw+LcS`|t|yvY΋Idz))JZMAMc!XCC2Y7*ZANޔ/=ځkR#qyzи.X9`S ᨾni?{Cg ^ÃOˎrjǃHM)ÏI;w& 47<$AG! )7j`bſE=:xWVw~3gXyJǎ-積m?+ |jK%$6$nxܧq*,N5ò2Ԧ3icщqhC7cpvbW""DYH)?уB=m|-荬$:Yf5hDncfuW /]X x^^11.a.9n|OuԐk>H^Ю4[OMa"Bp^8bgI7?Ʉ8#=^ژhwBR"XӚD;2NL` IR:NXIw<_=Sv'yEj5q>.ə9hy#ad1~ ׍׳r_Xw-D:Zl|@饄]3ՇF#ݤ}V8V 9?bYµ fGYmrqu4c|]x`&ðoZ^X5,"(V2kt̐؋f ٸ|SwmSnxzoAn-TA$(#qTieZ_y8t:x5X}T@1~vP[L ?b{|Wܣ?x4Nc:5qQڝp^CXf5uo{EO>_=LFxq~ 2VYZ/ežnrۉ^?tR׻=J6Ua쏣lݙEcvpAw $Ǚ;I0hDfF܀K]ADR _48xp2!L"&\$y./a`u&=,2z#DžրAI^:l=0< !5׻H~ +D!4j?B+pTϩkD6Gʋ}|0iÃHdC;R@6Y:ȝ^¨j#/&^܎!*|CFi;MZ#Y.>Wv`]joZWxRdj+SKH$oߐEU۞{NDK > RmuCc=uQŪIH%" XKb*nK$JP~ *$k G}=j뭐'vňқ&>- B$ib+# e"~qdROP()Gr$3a^B)RQ*QyuoU˟KƘSx6nu0(Y?e0jfV'ՍІӐM%X4%3Q[p@6h+4.9 5A5L$'yTs ND~2c3ؘ1- lҦ״쳕Q1~/% 0#4v6.@~~Gp!X̥#+ѿi-MuT!z-5B&zSgxO, g/&@k9<ʊt2/:6lɂjV<53$z#?͕p6W*g !ԂEiƔ4160FQM)8Dn􏼽s7[̵'[d[ٺp}/|O!͞#r|f޸|yt`MZCyۑK/לtiKy6QBc6nMBHp-YQ̴'VRxs[jξf LV1?sZEWy0ZBlF ^,ڀ?wN[h@-Bo|~*ls{ rhu{(&φ ]b1)W`9DEF]HW,^.ALRҗF伡N7mOȅ/ʼn寉DUi#w G\"'\DYr)e`_ǕHK 9Z}+꫶ ,Oh͹fowd^v bzTiCxusx|,"o)~#x~߽;?V_L2\V1uHt?N<>$xEUg?z 6ly4T2`%췐SmI!]'p^2A<ܟ#dz@/ c|oQ8~=>xD &/ipj1IA-|$ڊ 2xYK8 AX9یuG1bǴsș^kVm(O|J,D("dn=3m-ob~,)d$vCюq:^sA5RwBKK 7 Bz(C).PN3CtIwukig)_5sT_q` J\1Ba&W9'3k ;KetP>,QH3^ RwknI!O~>iD jsjfĆ[[[~׫x,yc-ReWLjJ6EGH3A<{EhΜ!VJkR\CTEI{S;JLj /GyjHP mR(NWA_K|.5L 2:r61I-C6C$˲pԳYh OLrg ^̸OWN#Uud/̴P_|>|i蹀s`ԛpxv5q")ՆSsǯV>בy^^h'xk{!(ۜ`R_> } /]ϩaҸ뀥`Vq@d#3N6¯ YrS=lUtkU3ǒ|-2E8[ń@X}Y66'pTG{ 5Ys9ɺ\t3X7'Jn<х1XEpT*MD)8Bl_{8ڥˬ9-!F~S]PQ*γ'H:؀kBG ?NܜW3p-x -l y}R%LQڡ061/:q;WA'Y1o"h3NA-:L `qHh3Tt_̎3Gk-(vGMzR R݀\ELV=EHrO@;B1PcjI`&jyݱ9vh 0o^\ԝQ0S5>D.i9DؠX3՞. kbYqfl Q:ޞy2>R&f, `UKr#{f{,GK?g>o=7 X'Wz*X6-8(4Y0AR1Sa8<ϯ)k5U s{} B+E 󊏻t=c%AToA-ɬ!$u7voo5I+,flznPWm=7~q! ݴ~AW'kÎ/oEeymanr8T[-ny{C6i\{W u#1XL0"W+R?Ea-O;Û|i6}t)[r.眓tKʙH3C՟9*?^_mu>+W QfVXKQ' uv2L_2HImC,Sy\`ݝZfjjK3HP 3WnPg 9N4;;#̋~6 f5y%R/[޸DSo ޼Fl_f9zχ |zs|SZѻsM#mvhH#1M׭l:96_@ZL0f\DZujgP }›J^#SyoɖQdGxqYx/ϭx,.L@^ FJx3Eԣ#tc0b>,6b,.'sfV-?z@iFMI@Vn9 osYx7( ~8⺹ b?*y7# Au`pG.t z\s  {%me"\?+kIVE^l8 sf4^M?@M)1ZjR߹$˩ոP/w!ߞYDXy O:yCpӖg u\d ZV}z GB!&z6c ,~e啕SOӣ#b#B=oA0;a7ХD]Q,m&V41fr!rtlSFEItDhg747 @a%"Ned-GTV!tVi>ʺi((BHDV4q?Y*e4Jw _ぼk]V5DnՌ^o:S%ҘK(Ly/-ϋNZL1O&:k#mVOOtoiӐx)W' toKW D1 honfDϮ%6@̩$zG0FE8j\_Zn E;:9Tahڂ7_xHD,ėB\Iۄ42#8 ۏ 8[@Ċ$H0pC t #bgKoŸ݌8DED^7~oWW{L0h}S h\/X2NN'Xh$;xC.KlHkUɒkGDk>Zt3Ly|4./m`H1h= ҨӶ +}]ᶪ'nuFEZ(ɪ Qqп*}ޣ 8a٬#(3%ySkBYuXMvsGMJdLoPOb]39nK?~QPw`b˱cG5k&jo"v֡ !efr"T +j\ $,)oَS+WW*.WuV!XҾP?|FoMZ>"߮MTodagӣcYTE\eGF]Dޣ?'Pȫ~@ׁ5mM6!i)lH8/㑥L;J$ȆC">#8z41Z+5^Nq 4UrxR!o^yHC?Ѻ)ߐ7mLCo9XJb\1 ӻ!MQhqym Lz@P̮=&ݚ$ v[ґKkG9)6tc!jvA1 (yD8[lK<jn srv]hA"-r=d8o 5ԝ oHZu6 a 95}F%"B e>FqQ+Y&zغ9vT gA#o@_tU;Ø-7:~FDJF엜[fJ#֞;zK}$k2w2l  up?8q2=n^lp?•i8I|^\L̮GxSc*DHuoj{ 9agvI/N5'ȽnϨptPB~_A+\BZȋ5ywT}$ Y47q[aӭpGXDo _8HzO lׁU  f@4^<Bvpt,+u)DzpNU8grhS\0xdR\.(aI/\ ?.8 qbv>phgb8T1l { ļVia3bitf\v.^]W`)ϭGscbuG*1uv F&`?bxs2b>pvh0fc3c5;?D?o~PXA f-fI)fl_D>$9 g<8ļYFFDǓFD:RmMj-ik"" Sċ돒WKsHۈaMYQ'\G.m7_AJ?%-fw)B9>lr6!=8!@FS":.}(ni+x+j+9QQ i/a1t~>Ƀ3WC RU%][ .mXV:AIih.AdB4xWz\1&+ lI1H/ϧj'*F%UJҀ;H3K '3G9o&>ZS~EG_Fik"NPN4xNO,3-i'T2F b=!;xS܁T&cրp/rOy1AA(NF5% Y6mVH8*iK&p 0N{~t-IG2FJpTr@о0ho8.;.`T;9rԞ^|DUiK&ZUuqAUT£,܀S7Lދ4HYUY HOF > %J.l tUtC}:X鰃~ 3|$& ynja`/ƽgp[v/ }'a6pxyJ,^Bt$$"y@+[bWi'Q˸DDoqk^4sVID39#pBoqдc4L8lF9LJ @}J~N ̝S v*(0'[lUNN}1V;'m %o{8ؕX⩥Fҋ|)ewsFIWe}Ê,%,0rHP"{F9L#7?h32BaIr,뇘,^ ʑw OflsomӴ6ᣠ0j`\fހ%ّͷ&(-Pԏm5ܩiyT+D͓)ΔP<:ɓK_|.",Y?ܓLgq/v:c^: k>cTt/cW꧁ cygqБ?GP[L(W0Ќb+>JM 2>{[İ圴͍ m,=@~dk!vT Pː|In7?.7Uн9YrD'*X`y)U)?(-k81o*k~*"G*odJk7cKc`Ac *unZwE|AgޗVs'N*3+WU_t=w'Qq~F&eܓTv[&u"Xh`E۲ӼYGw p.kq}&;FzoW:iJƝ7g6ɔ\H0Gdj;/Va 4pP~eŷ!.anCZ] x^Y06a\}uֆNHF5YТ( e x  j9LkI؆ڍQkwT螴w֝piV(^t[{CЉ[z5m/o g,!XR] ]gt}}aYwM af .:_4+? WGlܝD zpf]l)#d)b}p79wߍڋGa{G1e䨆E3Ӻ5죕AHxQQN5HGwv 1 yh7Vsxqd*ƌO!S\1C[/WWroJ};Dva;w q K3Ki%}'=Tوڍ1U.K^( $#"gT _ 啬bgsW.\<0wW9"Q[e/O4M9T{K+ {dv[I䚈ZWAX7c`mz5К;<"òF} gm߶&uܖ*+R#G/\-_8!g4'"z )Nj@ܖ oܕ<%ni*7mYh>ٜ=ʤU&͠ i'YaN5]jCIc/<KZ^) Ferdy":Ŵ-kv\XM$Vdk5# DߵFYm)lmQ]-Pti`n^¸DWuaNb|A8j'0P6g1iU;Gv<߈PN,eO 1^V3NLt?_&MSL􅶇oFJjƅ "NN 8 s"y>Ɏaf~<^5yDGԡږ ƛj('" B馞ngJ;5+4#>Bŵr'M tn1.)g:*?ʞ?"y̺\2M`*$-E ʫM0vRPt*OȌG VJycJdiŢ=q"-5: 2RuiBe ~3=cHVg<[ɘm̕uƏ0Jn&5y&;97|Z>[julՍ@/ԫ!yo`6 gS?w=pD\I 4S a.Z7qDŵ7 wg - "9gqjFXR/J3N rERAb!3KgK^T1XG%junIn(pp1_lYK97Ys?H]g<|WKmt&ʗ͕.tVcy,AB$01^Y2n(,6˜t6u͊o_Rgإ\:x{Ww9 ڎ8g.& "3ע=a mY1㆞PCN\;U]p_XUާ+=MDe#Q~kΘvV ۿX韴xԴk1 ̠uI #LgSG{1emFH5%V\ȼV׵g}~g| 4yX3pE}Oٗtat?AW9nM)# г.nᝒ %&CCe|}x]^8R6#pQ)c4L0!I\&؋'y)wN\^GjmI'd<9A葆2:9]IdVO鿲"'OI|p#2֜5Jz8GN!96:n@c?#db؍Ѹlֻ,#'跟+$r#7J674b[^k#KE2u\x \sqa6ߋDbG<`2i֙sZfj2.߆FIWƜδيVƹ<0I(TpܽgWcoIs[rpYB]T+1˕S7T`ɲACMw?[y|~m'> ZnƬTrĉ& ?j>c顿5\6 v*ٛDWf;a˄QA<˲HdD3!er;#%q7LdM~ 1ޭq4KMyT?I .f֙T1[ԥ, NTbZߖtѱLb0%j %w*iیN|cܴqt6h0~1u<S|My UnZ)E Ǽ"s$$Wx;:|e3ھ_dY`]MOpnzhK3~aOd&Ἴ1፴wg ̖ C,$ipE ޢS)i{ mxd[:-Za\"I˥ i~7j~,q|]WSn6~qOD+!ы:;3"Hբ>zq0=A{:0;oV`/I:7^ū53. rVCo|ç󚿉Lu7yLf0k=.@1x1#b+b"OB^LہnNbݴ/l XD45D&v[\"Z>r&=d{~&ޙGyKQQ=SBj&%ݘL[L\8D)h= Bt%ḝK*䋬y8/tBٚrjBK7jɇhim"<{I9"ދ]Bwn` C(9\QkԵp{.nPRV;1KeYG5l*I8eY@6c{X;PLM,:nBp v'|˅A3-XA^Pֺ){%9$EM Ga2SU uN?SDLLb:7f9f&3g؟FfHa.+ތ_`:݌}\3GtQC&:T1VQV6dL %y.ް FD@ȩ{th)@pm~lL DVWzRX4$!r2Sz5]6v12j6x GHiBt.MJAҍ@, >L3,\h>2GMLhCcDZf2O[;E[1IJ[ֳE4XO[cxH׎.zDUXےo:BU9;CoEWg#_Sߠ^ퟙO}CI=m0.:H]lQ۹{E&~BF}~ =u%?Fc^9rGi-Volf\q} ʃs"CX)^M4gͻO}t/iTPvb_v' "?rgk)Y%'iF/,4q%2AQ-Qs4x v,m uX[- "gǜrlx3sf6cz̔k8 1GW@g8yY\k5LN47u&qNpM,&m>˖}=#4ZClgo?ve :&,Ҥ0RB*|0{(  BRKf~|l%d+_:;@.ڑ˦fm`Woi*s\EX;ݑm eH;c(ui!h#\#NeH78q ;8‚ +g:lEh&ecx^~Xg-5g23g\YS9z3vK4JF)˹s+&"j.u=T= `T|_͈8,+•t,tl0y2@YWFKм#(#Sض"e5 i2a\^uyG7)AͷP#U}D~=s[ϙY=q/#@la1P~p3rӊ( NYa[Lnb"r` -H9%]O_Chqr_9}ZbZ&H^bjQb(,HhMOYGDy~6GV(#ӞBCvME'@{O0$F팜ͦ-NN95*J门DJ\0TZ(7ca܈\ˍd}28̇'S@7ڈg'(>AgGskpW]#.pHǾ?Np1Ҋ _D"-Y$x-<@p|6ǃ+{qxU62x7éM|̂6Sd}B@RRge,ti6[|3'gȰ5Fue6vіRvEp֤HlMh8aa}GNWҙV `H.l go<2^ K9}6ᒮK?WWm1KC*mؼ7 Sʴ cbuЇ5Ӽj:Pz2T_Ϝ"_n\$ec}ϐNyrf?㉐$_Q;'WۇbMJ#vE pz%٪{1(lx$r',Q:n^ t&M%۫"#)HENI2/C+E\/&QE~4 /p ֜Bg$c?m8`SFkifzXf:@$ᬈˈ )LazL9Naz,T4wܗ~iVK".cQ/MV|"_"V*-.|]39Mo Y' 2[6_0! te'״.9| N׀q^黹˃G)bzGXwIt=Żվx4  F,l"๠C>\{bΛPg @/l+@߆вgO8sik~p᳁BC缛̚܉g|&zuBcꓮ۫gwLEƷ Gyք ~*lJ9M܋`W}HVX~)/H*Sڻjo{d\]6S>6QUvbkw~-pR^jekuűc&ԑSV-ښں׵Z,ѪihԬXd9յֳ$R p\csR['Akx~F bɸb Y!M$ cK.N#㻚JHw+6&1UyĀX|:)'&G.ZpbfDB SHoQ)Քz)/ .+ǜW\hѭ- 6 [4D:;BAP,dR܁z;ii:%q\ seڙ5TaxJaAiJ ~tWn) z-P  Jqcul{=vu{5v ql֤k'_$6nf-0"RTPEIF0B^\nތ{t_X*j4fClpUF4rjV7EAIH9&Dp}'(ߨ~o}]fjikji5_GTFUFlGpy7?NYh8SK(ܭGLR4nk|jސdj}"v2Zo}|ڊ]NUoԼ/Whdevg~M 4u^7*ˆэy(̙ ANn[]C޹]D:Mw K&@hL#jW^5%f`-=ŅT-O}?P.B`7Mr⪖-v'EIѷo K"SVXt3q`8Zrd$3llkCF1|4O@h]&eEx>'c㶣TkJ.c(x`D!6DA|^e#a)<HZ& :R5м8B3~̩d,sFR8KHaE\MLgζN^͸mمOٲ-F.Q89R*z+'^y +7$'p5s>lDZ4>Z4esV$CL#."긘ob:_o{+9-Φ!]%I}` j"]"۔oČHk-wE7x=M8 jfq]!k.&O`5Ll<|y_Ä#:W *2n Zt9"k,PsZ%k0'`u; KA];_oɥay~S֨#n;mB"Iv$%0v@QWCwyF? }HnXH&j|29mseH~Cn KAT-k1GUMx$eW3h3XOo 'Q7BHR~_M; kV`C.R`Ο1 '-ȃhn+&"ĩBS0T#(!mIN!gZ4 a2' [&yMIҫ*u'}> ZZO-t[HӔz3Wg:\F8O&R׫H #1х,fB~R1Lo)NOq֡ m{9< |? G]M죕Do~[֗T8K"%'b]O65T3`ԡ5HV<Ttދ%BM58я^u;CpvaZMџ՝‡Xsu@}Ec:ɞex٪b3+D<}xm%8:(8YjNatz/AQ6{)ߔIF]F &I\+."3ٕw-;{7]UTFؒ%J6<'jg&l$,Ry&kٮ%p;z!հQ.hkam_N34{P;Զv+|>5!Dq62;]a,{։Wi4.?U2MWI_‡[O x-d=oV5D̞*&q03iLA[%Lafb}bV [̽TϦ{aƴm kdϘzײa?RxF0Z4׹@z`c?uvw0~'])l`9#moCCNJ{it}P`)}wV(|dIq`)Q`v-\Gyv#5ֳE;}ȴ_ԟзNZ6; !sB[r@E;X$)=lG]Qo@ϋMsq3:ζ@OBt e=d!ӉTRlRr&7A2U6 c%%XhOb/^a֫iimm'xԬc TRQ;H)] Pxb3]ȷS9~‘NYbQbVGJl{SM4lԐwWqjb|AԇY/N(o9,}aaU³WĆ]s$)D.AR~1<ˀ,M!b}"/Y #h5zAD V&^SH˻Ò:7Id;GH"yc*VV+ws%r\jU0x}1~5=ɶ(YWpIN35${[{S86d.)l%*ǞK_J^'@cN $gj΅]~߲ iRBfutrS 9=|N::'ӑ#ХCfHDe&( >VՃJ|K0 M38 g dB{y\h@R$ȼU1ePLRf䓼Enc:_N/ .PjQ\,3Oό[ xq>7!\+c`9eR5c9t~Nlf*0ǜU leEJi0$ѧ=䚯ሽ!t>T0}KH?WK藴Wf!U fgzE}Di. X>xpl=ӇBO&Yۮ6ed.&Gq5 ZHk5 c%_3Xl2bpk` ൻgjZI@ DsvMˉMs[- "O1~*!ȍY@FT gV `g:xy+ᢏ֢tBPXeӊ`E W`)W~AӄPָhn_<#?yp!sY9]qIcO!t@u(ے;|to_^6)1Ɲ\sTsnpZI%P8E tcY;N6oP05m<|ڻΦv4+Y)tA"⯤yTz"HO Ҧn@ip"h`NeҽةiK! @7-`$䆁u(N[  7UsrZ<۔~K?'cu4u J`vy57;[ZC{I(8X,1o\v&85=xx5`57nۍ\3L}w7՗̍XJٴ{馕&P>Ft٫,wL`us v2fLbFt=Xv47EEX >U E^Rc0c:1]WR,=aWWUvl2Y#@rR^|(wtfMYi# Ct.:R#ZɸrKodj̓*3JKq[Uj_ }\)FERBvu_k^MhU6&a-,yٕ'׭{c>e >{7 A*1aӺAe&xC>9м_3X.ٌ"qI@p1YGQ:P*:$_0 Y9iXr|G䶉QSnQfwyˀ{ഃ>fĴeF& ^" bjc+$jdN͹,teo2c.1AGo'ܯq#@w=:% i/' ǐp5l݅r P {$swcy3A\6}S9\avzh7n.9#"r|ᶒs+d~:ْO~ƭ噂9 ;rxnNYK+"-fXtPA,6f:eq/E9EO ?.6N} ֲhb=(\<).iܲxHz:ŵh+N  ɖ/`I޳ y2HHC7=&ZHT_$!QT/|Y35p*s+DLKgXjJH=Jfy-I*Vf -.8؝tw$UGM t_Ni`c UqU3_䶄[f:wOtf8{@F?h,d"uP _UU-6ŴǪ JeǢ0.L~a~=Z"[ߔ*FvD~>E%L;\%uGuE&e{e6[ /\Sv t%|TtOH9—?@-ue\on قj6bqOru.LPvZD dT{ _ܜýQ ;KoXQq;_3ͩ$heOAgu_rպZbw ƅɹyͫb Bh^1Nu*2u|%L@CZH.t4Maڟꑋ^E-0ij ~Qd}E:Bf3£ jm5h Eo0J13խ pf ciJ 6zW:)mB$)4ٿ<ؒi UM?& ߴ*7?"ٯchePkG#;'+jlXSzf}s U>20Q i+t5]3KL,T@yd,Ƨa‡)9o jZQc`g~b9%RwD+Ye(/P"Dmgg=b~Jt#d$k%pѥ>WZ}ΧAB[ەyl5ZIo&Iz Ⱥ+4dď%VBL0AGk$H5_$smkf^v5x0t8wtʆ$yŲDPψWȬUR/;P=QxGx%rck>,3 ,m<:^KI\*U z-.#+op%\-`+r/Zسj!٭rfꕦ꼇ڀvVBum gBZ!hoIO^ Im\-P W3T͇q[Ah]?EYWq0W-%ۅyF^.W?b`E'}\뾏=3iztWśw6u~/E<5l= %Z&7Z͏e;QK l2g5|{D:=H=l)9AX4:3[mv|p- ibδ;jzyh2tPᰋwֺ19{(99~ο o<5BH'*!=_g%ϥֽ.5ԒYY0 o޸MYpc2j9g.!&gqo}]~.M8+c |o2׊! ]G.>ӗtݽx L~glSo|I[JY]RWKM]|I^߾Pi>7ZA*0ϑuf 6J{y&Nu^q-}ǁzݝR =Wukn6Ofe p˺w!42w@XHNrb?b*3q([lLIΤI{߄^dЬgYl".֙>mS#@60ZOw[㩍[?۟@Z_@A|^qA%.Ɨҹ˼v` [?Բ x=P-}A"$wZ¥AEW0^Sp_=oH|xU'  F-pvdFW0~ ` ,eC~ox{֜׹e=}{^Ќ!/p?tͫ /g Wn*+4/܇q_6)C^ou+nz CmUY<6LV5pfƤvkf35Wn`C17<|en镈Zͱlj?S}&uV-`cck<&RØ?DHuA ]ۼBGu9ḯ[XQٸF_ [_s5iLi,9cNE ^\*Xn0'}ޜ:8r;?g >ħ`[ 5"~qI,q-l*tT|#2"PnqH_o>b0ƟTLhɈ43 D:@X$ }:'ƙKCX:!a(a"Ұb"&/+eB9k z~(eIub.hQZCy~Mp*%qjnb:KE _^  `{fZRrΩ}k]kBK! %qX_nqcCU(x5JB2A;‘{&I[ܴN M 4&qVS/D) b1Q2trvtQ1Y{wx^1_3Mk?ִQ>W; 69RJz5TBiEc%8KY(l\2Z3|IppEvY#;>盡.jH,C= QZY Fxo6YMbh*rlZ$շ5OZ٭NrB_ 7sQYWw֍i0inӔT ihEOk͞F.N$ԼiBؔx]՛t lv_AhDؤ\_{ዜLA7fh`" ؟$*2zWR= Zpßt@a^j ׌';oa/H/F *fKE'i>+v.]-)KǙQ Kib VwHb*Du%[sQ'SRȧѮʨyU0V?4l!SԅЃhQ~& כtH0,L\Q5fLZAJ]fSl0ތǃKWTzVn=`y;Ys-%sL~2P)hQ8# q%,bpH፪J|0&gpYп2B`|%i_F,.̹a^kdۆQ90cP/WNrsL%׈~bo(` {mz:trm]8K4/T^o&P$3ץZ2SAw|8Li0؏L!v_jW`f=ĭ՝LU: -e E%(LCQAr[<Д~yy/tXN\>=;П`j?2Aqj62-So lSgȞIOw| &? ;7W=' V˛ɾ~nrh&XA[J`,iu]Wƒ1TΑܣ{(8p/"(BŴk1.LYZĺ5tيC^g zSc>T>v/K[_D$4Ajĩ-t]fc.'6!fD2вh3+a1-; H/)Hy?5}B~:zkS;mt3+sq7)1v`$18,.فs&o8JRӌ7ԓkL( -iT@~h 3UXA 7oJ0SF4 =M+hΆiF MwTe b(1\__(%ٝi@z,K ߏOMe;<7i9ػw5xjPv6)ے֨3\f#)4N_(p+ *q5hnxlwl՝ĕkId{ĨFLLٔ%mBQ1]}|"3u V]a{oLMs%Ut,$}&Wh%NI=L\Յqۂ͟fSp:Dv,"!}ؾЗ30MMao!陾I( k1M*^]C9ݘm9X̓-Z#YAox oM 7S`x S@c^/r ؍XVj:gDlOtHW@ \% ĜpqqsH|[3'`%'NVFp(}9uP4\bő,< قC9;LׄNъY%,Ga ;ANb*LCoiŌIgf$^`&WA3QlJu +o oJ+'2NJ@}FY%~N?熩' 8)c+vr~[k7Og}xۛ|GƬ1<'>f oVVL òx1=FeTr7$btr"Zd |36 Ce3?AFI-}aҎ44&rvF(SپFCG)rߥ_n9T~] K! {!&X{G 󹍂DŽeFd[*G#΀gty ^l))؊.c=xa>p4?4_I^c{~E8@d}M{~ uw8#G Qp^[y6T+4q?^9_OOH3(4/ԉ{ڗ%+HzE/5k|Ǹmog s=9yLkJwك,b9Կ%IT&,c?٢AЊ}Nj {9M܀ ْ@2o " y~-F;WHCE@.w4(j#} g#wЄ!8#ԋ J6 TO] (<^Y'JQwx 8QB{5+W쳼sBM`dEV*݋8 nٗ8( -#%/eۋ2Mcxu,5ǡ3aewdm3*%Zb+⭈g{+xb]RXڗZ%<s솾#I=kn]o ;>of=k7en[#Kgũ0oK/ֲ*xCSlWC*$[Ū<|+}gv}.&j ,xY-]jzCQ[f꓊ -} >{%"D^vE­Hrcē@4\*xKaOSw ZԄﴲr.b*@a`"ZKwmȅA٭0I]mBYAi61a֊k8XZN'Jk(v D-^b#To&-LPŐd|U&])7Sfi+etW? IqUV!<0Vb] e'lՑ4$]y<"vR #.C I7Y?Rn.[xboB9jy,]{PPf"ޢTԶS| A Rv~[v́ \بv`}߳ݽ5nrVqLg"wKIr_xq PBj'B;ZKF6lw~vѿA.Vra6k2oU DU00XKl+ 讆aDx{  C=+!89xi<שBv/iZ^\y}-VlMW]ܻLw?Pi&YxY4*rO_30g;AtvUz;J1Y+PRYZ5\+o-҇܂* a 9aTo7 ߶[2;ږы Hd\ TxQd:eXqF v bfضU @aqǙ:ONp&#T9/Qk<ȷKsp#o_9w.f̟zLDRn[^yNv^zLYDͼacԡBo)W󗔭ԋ%W Z+2"]f!SrKdc NAEĶT'Iy!㨺SiQ>RDd*=dVZjDT BC.LoSʟ4޶:oB2Qa),_ sR{$c!7<rB(9 hۙ^\9Bg+&Ka_Wvu~K[iwgSTOr/)l3ZK%u Hy*Xlxz͞ӈtߎ(+Qvl@ v"CV!bs <;y _ٍfSˬ`zX{a\2FޡRt}C gN\ݹط}qk>oNw?1{c? G6cLYI#1]IuTP}Sji bn,TZ?+U䷅6RdG/';ʠP_6_>-<3<8{gDrbȋ9] z簎&t CAzob_'gEM#P7wjgvSjv M4sǑ;W2{R|Ü+ Z6:~@7v$\{nXVSug~`a,/Zֻ0?sjgt+Ni0m>*mEE*>^#[m~X$sDf=}i_PQCj2ǸmXkc?dksM뾶LL2>|E3d汽_(=[KJHƕ}P >=I1\ZcR5\}ayBr6B/RuǐewI!~7{H3ߺ4w0?F2=iG&y2< L 3ww۝Ѳ Ӑɲ+MX KYaެ=u1;a|t5j)E?%;ңa{wq<ԅLnހ)V{H5~8X_죁};OێS^ߜZ[1+N V}"tx8@'z@`0xcT0kࢧsu9p?)Rś6!2ڑ2$P/"M Hw^{.h_$5]N-2WGtDRǻd?zQ훴rDE+7uQ2؝O{}X{T=[4${g@ycdžIV#mK{oʃӺW_O۶yNZGEJ8of" W*oiU.lSV5?67014DSOzџ38OB0b@'o6itm=lNi9R[PD=Aњ%vyMR𤭖de}_Q50M&-R&N2+ڄWER!1'xw5ԏu$ }-u&aL5/Y6(h۠{+c1EØf%f^{r>Fo}O1úӜF2V1okep^΃O~8yb\sE-tZ'N7v_ݔk3Ey B>tH~cK7 ӻ!X-'8#{4.D#SYt%"j}{Y#ݒuvM\܂e/@ VBC^uAaDnis:(ߩ偲>3O;da++x3AXpq'}L]ȋg;Q&UUOrkVR-wz{Gc瓡c5ˆ"=O! lUS5AGZZ򟴶e@ C 5V7w^Rjo]!A7FZ4*k1RgV('Xłbd/ VCmxZ&=U 5A]}M[bVΩvT_-:kQR/ ")Q۳`-\=QY2qRrnt8 itonZnw:6?M&"WksJ̈́-BEيC䟫uS ±ߐަý-9YP^8<8?0+>Z" SpW+#4xAFȪM .k: &9TF a ٫ȿ?T覀{\4#!SYE|Mk|Cjl֣'pV32bɪ&eb/uƀ6J4قRGdz@y1PF 4}\¢!Wq>x$A$"ߐVRNIofUty l| $qS%]LJ>4 )BVƯc.MJ+$# C0td3=/ |yg,c5@}eJ1#%(ϻD2Xs 8<_Gpc໸K)/@rCY2vOox*Z|EHyD7`&7LpԜN>5k["@R6>TnX ?"{VtlW攔{Xq[ 1?L>LJh.nE[bי kOi7w(+j 3Oo+Z!veHw!Z5 n~צ'UHvkk̢Ў;iR'=7MUI0xO_+:n qbʇ|j| mjA}~iHLwa[QV"6%`QJ#i+U<=kbIt F{ؒZt٦E EN1hL |"&`M#jaT n25}|F)% /$-A= HrFYguIg.]Pv"0<Ѻ M EBZ&BQ+AO A2sm&Rע씏[hbK%M. eʐɡxPZ $>~Enm"/zG1>ؑqq%IݗKhm֚u6ڤ㸋*ǰؒFYB3릂|H bF^'f gwDEzJo$.Fw?3>VkC0;CwM0qlid`qMSߺgn7`6t@{ޒ1|,i2,Ud/bߩײGO6-þb =dqCTl┢6zs0;ܱ-9Mܰdf4bcZAL2F$0XY(Fb*KQ$nީE߹j{z]Bc(ߴw|^Zt~}#+gl$2 2 @nޅBYc\2/PqnÔZ4&_ь,h?_uQpc1m>6>rH~*B+@~7zG/aCY{L<9&\ir8`!qe3 $b4d)0' ^iI{db#xhv#Wb )EBvpV_%_,'RA0~۷ќy[M1*PI'(PB.X*[_t#=:l)yo@>)1 rԈWyUSzD퇨Bӹ #.ām8X ^[X 4[u^RkU1yZZF+ۏSM3 uo{ wK[cGAc 4\m\.I[';y#)ORvT V h߀ ru}5.9OV:y%Dۯ%_Mhy8b]5 aZ2߹)XI =[+F܍x Lo=D)d=n!q5Mnr =\HO/b1 I\3˜-\b48Jgr(5P_ۚ$!@<<7uJѸk1*)pPA3|(#`-`7jZUCU lO~$[GM}^OFd_t-1}Tˈ9v17R0Z:$yzMC襩 :ct ouYm|m[.a5IN1-,FмAaP2qlrǘ8:]af7p+Pdbی#ّ E4% ʏqk~0Q, |BvޙW_Qom? Yjn&:({S?ˊqRrG%5M(IZwG~} c0nqYS|jI@g͂ lAg.܉ kf p'# +e-][Bp9- XieN1yS soPqŴhn=6׆a{r|$Xw֌6 檙k U{Yk A֎Ֆ`#kp1[* |B9ped_`i }](2@D {-4p^EF=8*>N#؋ |%fKc}zH?N?)S&J yI 5.k?,'1% єɱTU*UTŦt {J<="2B|iTڬ`/RN6qTflg]hz{SJ(뗪RBc6 k9ܹϬ}ٍά=*,Yy,q$5K&ޘ7İ{aC88 @,h[UvƢ7ݦx;uRlE*Z { {)ؙ[my#ԉM>eO5[߯-_s_6_Cz}лWZ]X,mZpQRF=Vf"J7+"|mQf d1ERՒ'z;]$ňFf@= !j_]y-&,?TZ_2 !z5$DɵލqRObF(0([SjH%gSRLs넽DcQ3w`3v.DA 3BPƉls*Y(a~z"tfI ^{e~N%'=#+v5Jl -}B)"R'pr2m:9vYp#wCsȾZa+RV'?zF%co?vx= v;>^-σ8qto +VU OVdRQfǔrsH~y2$ٖ#=8gBR,/4kfF&?U*n2ëHt< `1#;lnTv,ud~o7M̽v,Ríf/.J7X9p /Ep|Avn]5yʎ.P+r aT~(FZ4W>3=!gz0*mlFO`~S<'$oBuv[r^WƧ&SgIk_zH_=N[ BTBBת8?2疡;*LHhb]Z:TE+yekJ4/,PF+GT>%~QelHǸb`~X K5krյ$ª*;80'䮜Eݴ G/ogI1NKg^Z3C1C͠=Y").3Jbr Q;P=Asv^bcT_MYA)=7:]UPqڰvfղ$#o9][mZgY)+"!!;=N+e k sB-V}UB fm5U Y0(u?3^{ fքGxe߼m ,3U>H.򞛞r'Yڶg8M#j8rN[;se-bI/?A+f[RZkEi15L"\pP-6vKcXa 53o~35V,o{[yY7O<%OS]QmBG_IQ,HöD4 ~死_Y:5]ʼn:iƈË.ju; _fY踅u0W=#-+,~m~{j턪1%^7>2r$pz dou=ҳ_w>e~a2[-`7f '!V]SFaUyXT]eJ]7q%u,uȉFc. `ABNp'0L08nݓ}$w?pUzNuU vN %AD\ Y7PxoKC3$xr9˭{E'{ZTh Y.LNk%ř^ǎA+3Mi zRԇC*ܻh#7(|:y|ޝ/ i=}k̞AK 7JbEY BDw@P tl&V KՂNg!֗5PIsR,7 33_MHc.HEG&">M*;'l|ZQ ٳIaBk~ʿ3WRY%lVM3 B~LŴefkU3VPiS:-{9)-6s FOMdO1S8Y$ޏ]'Fڧq,wRT1rIa@\PiWy3ϭ1=V+Κ65 diM: +uYXŃλ4ǡCEVڽOFZOx2FX^ c1še@T;gh|(zLI8)aު7[h/@ts :~s˪cɼx =f=_5%d96>P$žB&;t1Mc7.ZW̖ҘV }8~bf5gk!`x3@ހ[LsVO2Dz9R@tв8Ϝx# {is{a2rZ4/: JA !-eSQc&5i/O9_Eyﳋx C;Ryt4 Dfuaz3 "]Z'ҩ6HUҀO.苝]y5;k"R 58I_5A?o¥1ઈDhn Y`ԖLr@ sQ٪ߨg%!ؙ´ŪUH,ԾM7zT"nGt5wFrޣx+&L( K՜@>.L#rրq~xGs4 v۽┙[܆.5N"͸G>Ǵ~JZw( + k#/OE`6GT\zN&o92(=ﮦ7WG/]Kun_tJ{ 1 w#U1Eb}?0td+If\ VBAQ ics#Rq> _% ̢dyZsgPׅ$~<+N%$'H:SU?)llEFX&|WV'[Xo&(,uĄ`+p'y; L5DNlWRӔsКsS1^b9d"|6Ks.cE˄&<  &PukI Qs3ƽ:EOd\u WtH /:4 1x@Z{l+s5s(7fQoJ=}+E$n?ҵGC%EI3.[B܋j AH=k%g;P̣m<]y(;(;jf6 ڔJZwŏB]LIHKCp}yoNON+M |a#Dr*QzCM'gw#mWxJQOv*͂ Z4p>mߍ>nߊd.Vb=Lad[#u3BIñcw)M/DPH)GQ_t4|ɈU{ nkuk~-7%6!isehwmR=j[|pSpZcn"m]c#?󽱗Ɠv(B8/"uǨVH@*S@W݃F,Ev5'B_9sȥ T¬O=\8F ;]]Kځ^/a_SoQw\iIgϕz#b'f٬@luRĿ PS(kDkMF`KZ:Sqe̹ĸıIf~Ξ5Zq{Yyl$~"tn= ىH1^V8P7QL9ưiY!tweS7eDw˰W2R xٜ@NǖPih ?yt.=ŕ@m0R=򍢁#(‰Rۙ-_"~w%ϗfQe 56^w$s-Uh?̖^] 6DW{j˄ewYO)1괸TjhVS`U|u>}AK}]_ͮ8uc%)<*kܡPwzV @7}Q]m[eŃݰQ35\-7'.\ZI̴^Ynྃ~Yc rgw`%VJD‹>rtf`ęy&CoBHQɈ~Y6 I:Ywv *DԌb۝ Ek7lWcRZ.<~Ielm%b]SyT;K?=Sb9 dqݾO9Q^_/&26 Ȥ[1owhڙâu4Q1hd@]aX>~|Q%b.ϊAwoc 8?JzIXY9$ݎIa4Q1ZSbg!+,q7.z GpWո [46Xܫg ZJGVTO)XDADEӳ{tЅy6wZ wInŵ4w+g B@>da+l"U[i`=~- $fӜz ;zN> h %.صWĖR#N^ɇQ9d S$]A۠-cƘc(//F(TN7U(EyKE&ʵ碷0AX|^"Q(oLëCe{f^Xۜ}mx}\[ViМ=͡h"4}VoL?~ʷ($_H˩S0V%LHlƴ-=cMSȼAuL̟8 o^KccpvsWy}v4wdyuOY9L}YSGP!ڿ`kGZez_|o?drK9abaa!>!PBUQ.+lM5PoX ( CH 5$_@+tm%]:OC_k=$ݍ 2#*3HָR4mn Ezr*]iD 0;T&ܒTϑPVKCq#%>`gW·YTR7  _V*pup=0I?"ىyXɏz*,ps̔J,Iֈ'b.ZxkN*ψ_D[[Dg}3(`Q,.?t?}0)'(O&5)ć+Ӆ~B2pd(< .łynLN'wZJwUƊOȂ~ ^FHRthYTv.3GXި}Il\N8Yu>ѿG]7KiPH&8W`z%ݨLbW\IJl<][mf?ڧ&)99.%h`.} 3nHu"V ޿u $zIJf)uUϔdb!TPd(28MvdN >X&rO@ ^X~y .'m垜HGm.#_v/^-,7]P ll%εaoZڬ/2k6tq[jfzIY)Ef{&xE"PT |Lv$H$YQs Ti[@MX/yx0~;B$ 6AVeM'i2h䂌U"Y!%|xYtT==Hy3IlaI(8'4.M56UPfP%MjXzKܥ1,U~sp(Z-&?:'SLvt.n.aؐy8kIG{>C:2)tH[+1nt0u'U">h7s7M D<(zB^>aDu@rܲQ>i_:nY/\ Az?hi VDŽNB|M&r*ϸ4aBkbxNV,lt;7^|6uJTIIkH1i\v!`SDOzv7a~{ FbY^|2)oK*ӷTg׺Xj6*O{ʹWU;h"@J= FRU"ʔԓtE1m&3·Rs%C}ðy,& X Y/M)vsOoS6iX%ZxRFSu1/ЅoTM HaVEI'6!]T-zU5 |^mK[W侸 Z4f 4]R}R6.‰lU!2e8WX#~JU, 8)lo$3*/'P{#e4'ƤX* a+!ɗ*_^*kE2*5[Ej?CFGv=[YԦ`{t:0VvRWB|WKh];48GhTxEyk|98SniLbe>&0Ic<J 4G씒 RB;j/+W5oh˟?ZM׌ò҇^#сM]Cs5?"̎&W 6):Ko3uiÇge!?،LO1'imU'wR <' Tځ\_@j*"s3gN*Yg dQU -KdxUDQKO3_Nƙq6V uyRJ:6_P>{S) O=aLR'k֝XN0ȹX,p֪Ia&hQ{8RLY1(6+;n] S=C@d|_o{;xfg~U= AjjqH>n(vQ_"RVG\1dM"=)f[`[*^1-JR f_&yvX7d6i^)S|emr,aR"L!E5F|]N\HפsU`6km[JOBS)UM2e I ZTl6Ӭ'Fc\k&t[  M^,^trsDA'҂=uOdlD 3cdpK2+s-џM ϢMs,C'΢ǎŶ^:NBKC2 g!OЈQ^VϤoS"6̴~i+cγl\ׯku¸:p$(2vP6ZiFiD: #5룾4 Ec5-湤By|YT۪mnm&mI"NA(5+gQv4CcRi](YQ$[TZT!U^t\{gjj<8VVoGj",3:to(Wzw5 `ȳg {`|b>r~s2% m6= GI>_A?W=avBx[.&Yߥ,֧Vn$&h䣳Ji ziMsPN&FH/:AGxgU]&Uhv󡫉-e : caL8ֲuo `šM 승},N$m&S^JXj7M-PoП#MAk"页j?gR2aXw vKJD$B4mgXlgf=V/0$4k5X ꛹mk۪ ¬̞IpIڎk i.D1U~َ%_=QM LmNmNB;[)IM1 ύ:=ޚد+wmfam1$>D!_}DGҖ` Y 1ԪU4A"߶n+؝=x R[5=^t>'dSof͡fV{lzf#hE2s `xJ[cdMEqrjW<{@oEK W1U؅ (1fUT@IKFa3gD}c hL©zo&rQ`~w+LF?G QI"VU7|1w>юHrQ(QN M~?NV[4_Qg3ʇ#?P~W{3Vsa@Z\&JJ%Jp"sEk\1LP&=$l$`T"YX؋)ٔz?!9NdJxY. woL^* 4AVnn*3Q{ c1/T 9*&?N,v1;67R6d4R;O_vm4ضRzm~]TmmmjFǪ_XjAeM Yv}`/qcAeZtTu#FzQMQXGDT8n*Bw=P=צF<ݾbԣdHb*XPi ;͉ yi;s6JT³gݫO&doiv@sm;[ ېJ.fCܚw(|߃[ $//|'X_E=EF9V!ڽц{>Ws ] g<Λ;&{IX>"S ڒJO=uaf7S7y8{ʉxp<Lb)@^'껶/Xj)g2M˥:w*#!*Mpc^5X>@XS%dO]Ҧ-d(2Id.eӀZ0cR=m1w)gL`Wn#BG:9p+4iCVX! knJ*D5J0vJTF dqͲS_E2:6w%o]2w8<+F%Y!)||#+$Ļp]ԋ~Mr0nDL"g(W dB`7Lk'gW΀g[ |[ڵ%`K 0|puidp,gu?*ʪ;&s?+LݳIͭ9)5Ϲp<;zRvoc49i 8jBw4^p_x Ka;[.zX5l;I|&'%F\#xw3<B{Y̖vUn-}{'E'Y3MIÜQy&gы@'nI<> $lx3*S=Q"UcfAY$,* G g]9t#tk>^mrS.lN=\[5LWdKlϊfP'aSFX[?}U0;r\&G4RFxݴs:AW_I7Z ɼ dQ5

1U"j<+2ΦqT╢ˢ-;3ɢy#S~]&[KqC_Y՟ˍ~d"Kiי~ofj68,./+3[AF0estXߣ!3\zNnec'Fҿ_e9-';p }B4imo}7,꡹ 3-tiTG:#:\ A_žeH*2GD`nj>~))m+ kΆ(+4;_ԟYb5ȯRu;q(,q+BSu&;w&*=H=ȝy[~e@> :[%[_P3ys;Tr|H WFSAcC%NvϠ:IZ$M!YyG;U, J[#zi-&ՉȽ:+Uo pS$yR|U) HeՀX?/u]M~n/cQ.HeݐunQa ;Y?=D #CrVw@*3.9ޤ (*5Ā]Ĺ4NC3>6^|?N~w&YToabk1?}qR)PTSJ@ReYeYk;DAL~|~w|gfx9s?9LEaƎ;?RY&} Uy2^,pO3$Ju LORBH^ 8:3mιX`1JS-|'{W Cx|3US%A,%V >8S?b:"Rh}&+0e#~oP$e\9tecq3F8UHFo}_fjӷ}Y:AϔQSO)[w8EO3VD2ScHojFz״K24:4Uv #֫Zt%U!٩"X(|D|z&&}X8^`;aU( e*b"@ÞO۰d*vVC)Ñ$rEIZE蔟|YM^z)6l"HoxLb5}[U˻M7 tCr)HYzXLoNbݹ2%Q\iv1)lZWYԧȲC8Ԝgq}yIE i̼`NqG8$qf}L۲4_;Uz19X6 ̊R,ٝҗ_PD9 :\)i2MhUwUa'YK-Zt99282|[GP!3+[Z~jVs8. YyROAC3+6A/VyJ~"Od(z%n \TAG펩/+?T{,1zZxCׇ=5bQGX/k)7j~d~s'aӞ%ފ}՜Ղ#ǯ6{kA `5IE$8| )zJBM ؤBR}^*!FuZabrJA a,VM\eTE[^b ~O>!ܛב6:Ι qKf/xQY/+2XN9IIm9\9I <]{T]C)^bF'ي,C%m2N1u !nvbI+_Yj%oYy2г)dSP_S/_m_wH1^)G٢0ca-+q)@yӞR8_ ?m+M&MdwIg׳R s֕(ݦYo Q˄@-մP"`2zR+,k_3__NA½Kb_n/)w)|* -.XQ E.W"-a&(l}81/O_+b@cv0+9?~Z mzP6R~={$}٥v6=B T|-Grf`j^v Q + ɊU:wתfD.33OnЍ1ECEVq6I]*ĭW'_+&@ɕ8b暴2rD_Hc~=aQAd]4Aԛg% xK@U: . NT2 );qtx{ceY!r0@wI.` {x)з+qf;vX Yq+̊Og?a;b1,VTݡžj#bRsc<%\;/HҢ/F zζ(ȨR ȝ2txlUr*X#]yO)_87߭?qj4T@8sjZ8L'ڱ3Y=JIZ^V!K٫*$Rpԫv]M«[wW}.AHIe'R!2ĄV򍶃E[4*4xV*\B^(\}[U2b묭KNtj[F-<*W LXpryz<LQe#Fϝ(=]QXxsIAmҪ@2DzrB,$"u=o:_m'|f܁sk@= ]i`P L+X zJ!BWUxB'a*#c\Y`_ҕ*G;'Wqpr*GjK HH"TaCNGUHmOĥ*V'"8˿0~D-!K  nn$%aEjT,!6A{RIwIXWs H[Z;ALxI>1Luo1A&V'њ2͐ap2 }>]Iӥ3 Zi.iu/Ҿ!8ԗ ʄz xYRM(HO9~rNqܡx6.p?{ Ǻa Y>7u2Ւ$i ZiD?2S~gyA|ExeKs2 Lrt]y *7i1 XO ]fS>}eg9sfr *(2\dLT^KmwGg ~#2;zubwpTB9t`i3,Ms' Aeor`yB9;t*Rc`e9 em4be q4..BEe/./)XAWDkŻgOGIVVk dWpEY,VϒLrijQ/xGA[c% +R]e \;DsWY_BOg<׳D ecɬ^@ \2f~7xTzs]mLw!Pnf9gfFJr4{b x_ ^^-R=nΛ &F<#"hbBxY7BjҩurK̯iD 7n}6"W(UIP$qLXjLSdFyZNv;loސC.pȜW/&JeeJ.X"3å@Ƨ$:[5[+R$W? [?RqKL|Rϝ|g/<}T Gmx'm;[4հJG C !+X.nNX`Yw8<}G偊_%>H~W^h \Yr9AGS5 .e$XC/ /"a HB'5y'RmӶnJz>&`zUj"{=ՃNU6VH{)jMk;f,`H'as'oBWhaa=^qNxm6Lܠ|CfJ-\JEH4TFVScȓVƕ+F&†ӀT xtw;y'3dI\n"eeÌ5Ote\ ?'J\ *p#:Gi{b3\1}emBޮI@;7h"sˢĜ>'Iivɬ'UYr7`,Ժ9la-a`RoLDhAƑ> C^ "=/XGzRr@\ֈ\aN>R澩u,*#(7/BPG~3hKkU`WئszF V}N8LTB"o!'P~)fdυ!LQT423A_ܼ#zy(Ӿ_R $@|j QQ^d;eKE&p?wr2< < EQ&p{3O xsQu]]<CwQ;3M*#Ra7} gO}o!j< ,jUF)ԕH)CNۮ8$}h&BLV՜׺2m_||ɕcUӤWq-Wy}:~5b{pwn FUr@Ύq&A/%$sz}3n Ob[)*UuOK ?N0 $AOCXz99[3V B  &8ս״ѧ`U#4̿H+E=hUA&M c m3GhJ3t"m/ߛts&,8pK_ۼfח0`+?hxU Xx ލB(Sij/1/[']^Ű5&m8Y#ZUHV>NoE]RC7crc{ێomiQFi|4J* zW~Ex'} *Ԣ">&fm= kVoGhlQW5PU`J?Ep ZBN,k PV!KZx^0xIbQW{r=׳_a@y(b`?Z76>~zє.gDm{[C*; >;8tbS7N=|n-L-/.9\rUkn]Wpx˻L>p~?Ӿge/b^:Zom/}Z =GO_7Q?-sM?)]P]%X]jBf8- tn;~PW1KoM77n67t4Zcɘ adu?Yc<]]l{6>)"z#|@;R||,7T V =s"E-F9{0n_lLLlC8y4DٜK7)QPlQ) CQ&hujcvt"IdSJi#/,C?'[Cv9#ɟZ^0ѸEշ1y[DZ7?5pghͰHh؉:SNby{fN>Sg?@C?=swzO;Sygk/.^\n2|*+7nʼ ˼'/z}(퓵O=l/c_ٽV}~֧/Я!Lc'WLny^reUʫW7չ)kּ+Q72nB&]$@a-O6>=d"F)[.}?ח~~g O۔:FuIA=GB]ZZ:,׽Y?KQ{^~&M?7"0H2bhȸd)3yǭG,%V6j6wmg; 9]qpm+v p}cȓ=[ϱUw !֡ʡF"3D7/LNJ NvJٜ)aYM9\j*Z_V .).5l,ӄ*Ax[/V;CL [PR4Cbp2O!gQ2,jfX-tr'yGW/EWil U+;ZQɴ9~In˞gaQqD侩~6?5wkσC퇯>?vɄS7Κ+9?zKK Wԗ6\by~s򝸻^0_k5FLٝ%G<NggLFSͿP1$QR ю}gHPɌT#qī$$'ԓC:$}b؞'o}>6%wW"H]$ D;x@plGRO\"p:$ n G_soԽ=Bx{l$B+BkChpN/'JJv)D# ɐJg~Zo{W?3y&]_;ӊ+< ]jP\h;Dz'bY:Fr7#G~@$M Cicd\8͓]L=KLfS|m6@%&1˪G>8=FalтcE A[R910nS^%ӗ?+L% ʩWxWnP\>/A6D8>)c+-V"dw,C}?1N53b./؀)ИHc?Йo_Qs:iGTuQ|0M(K5(@ R(uPp,0uZPWF~\fR倾hi(C-wXTJnc0@q;OhJ3cO}sdOd ڼfC#HHޘK ^ŤUBV2WD2}\,ȵYM6`<x lf؝9VK~9̨#tD'ڮ$6NE_ %zE6H9WQN/6#m)mS4w/ՇƧz%ٮ[JƒgxCHg%>6$1w"}H:ߟ\Lu@KVDcL{F6Z&=p #鴌v&6yҏ6L+y>@yς{9b1-nZB$zQ_Hy-0oRz-ƍ7{N"x^^Fs~n4ng_!F1i~ "5u8z=Z%afV5T1p*D$Y`/eswʼYK۪29G1rhi^4%zjImWY|3KfIWX,#L6!0/pٯ8ˑs&&*8Eݔr/wO{pZ#fnuҙj *"tl'=UmN #mOxAT'6*a\M,9~[1gZHҦ.J4}>"- N.юR'=VH qyFAL6öD΢и eZaD8F,Tx;Z0>ٻwd~t^dї*Ih2͵e13m \<l"Z)n8 ]O3On͐NT#uDԈ3&ջy(\ {vS~V7\5sGo7Mfz~QEhCϙ&\AFjoTF(<lx(5Vs<+6У5VMeNھ3|+ Pt!s2L 8 6xSjeHCŸ< -<$B,&YD }EfڳLS.^m9%<Ca %SyTKNF| 0dwzH!~.1j{J(z4|@n|;0dݒ.0!'[Ŵ{K%j2}D=CC@G#{eMmo6K,jӱ*~Epx,笏g%3fsDjk,(Mi(9zkt.c96K cܑCtO Kw@~$i?Գ7RT8g<&UfNs.ΠQ=?wӷײ^Ro,Á@Sn#Z}˲H^n>M j}Tyrpb1/r (u)pnְ5Uhca{j+~cQ9-k^<H" r__nwU\pu@s͖'ڿU78taxYe󟚇;YEIN}F-nc1[($קlӦW_o]O5myҙk.]M[k:y¹ i ".TTC P&v>Ek:X(9Y-{8 oj5Mz@1𭰬9%{nj _*9z9V(hodwgyhC"Yӥj7^uck!Dˌ)yϱ836j t-s)F3ސnqϫk %l)5"̧rH9'$G~A3;Ե $Jw-4㎭Ȼ-7(ҺN" ۧ]d@Wcq TѰtjۛ~;XzV:cNKf] }:BG(l]uiSۏ}nhFzO %8my\:ҰJ%aGK`,WBSCo˚ #[5]k)b)CP4S&hHyYɻ#Ƶ^Q\&,˕1>|sђl+jEjΒ[e1O]'N;lGf3jPanӛՕ?ՙ׾tuy7{{@aln,i Q:Fۊy/892w3K)˩`ȁWv+g&=ooZ;~,aKR##@r{X_>:wx9}խ}e0xcO׆3Cˍ@ALžɟ6C1}C~6G𙊙Fhߩ|FŤle1$?uwCzڡ]#kVlt:Urqb ď F|=įkM^MZC;Mxl~3}|Q{ w3Lo ۆ8D\ An$uⅻ)Ʒ8X*:K9Sˤ@uYSvnSIh|J_wp|,YB:U5.S260wi3Eؤ u'#׫J?՘J/ N {(4qxhG1u8 i]Ͻ[F93}4d2DR)%O㩝@eYGh7e.SF O=b'0"G?Ԑ39Ué5f MdkNmF75=0nڷeln1?~Ca΂k|_Oy]5<>Ӯc۝,>3rc>U}qG;{m3/'I; jyO-Q_.LUY9̟铱E?G$}ԣJv?ۣc8v k.׬{)𴸇MY-I @et$x?;|}}!m3At鞚 ^U(iS̎j=qf0c$|FGۻ~ )k17)2xӍ iգU,  TMY fMFf)]΍֔Q|25w/sl RZ4$yP5v\3k.2ǣA ޗ>3H)ʣ#?ΠklKw.15Z:`uq z^|Rb4G=M@9qn2tVNw [?a'um=px#U6e}|s, ql +E%}'QiE]kQit?aZK0ޤVz79VyǼpw·}85;(! W5Ռg]Q:9:W60R=) D>Tq~Dܳ8IgwL13p6.O[6<{(CV|ZYB,դ, n> 8^w4s`uxԬ7u#6+ igwݝ5Fa=V:if`'GDMeޫ?l6mh(>hк1mOlrJF;K6tǔ9\{$8Vć6^xktvrc{ _>H~ndAjB NI{\k$ol\82l/]UC>-m'ZQۚ ,*k\b_h"ee+%ѳ9Mԝ'Ѫ]P!d;2ٮA xYTg-tňђ6a+uI&"1'B0; ryaTgKv;IZu4ZM.phЦXHR eJ_`NAD&}Si5cN!?t)Öd%JH4\RyȋYUfQL# lbB'>E^\+Yr$Fyh<Hp\JVմ[s+&cX¡ċlجKf<3[ٲQ|ah+g4?Ԏ-IVY~*^"d }TŇy_B;<\Mw9[ux1Y)ǝgqq_XOD̺5 2%;? [UE;ƢDAQBE$$]tw)bحcckΠytGBzlo#lEnݏa}m R"Adou8)a:+wIwrNć͖8j$Z7+* ug^(7RR# JrbQ,˕ۮ哈fl̅p8)eQ{AU+i giM"-+%:r,TyQ-/ d0X?<M{|Fבu{NJ( U5P@[Q+v٦:8x,nOD[sӑ\t1YWWޱr(Soۭ{+&:֋|R^>/f K`];RMoƪ2BZ27•9w;jtRW2fB7J~ܔ{%YC]{Ik:R0kTZyIނ+NYg@*m{% U)]QȁEMoߥ5r p㺵B8*Q}3ǛUV>+XUj8ۛ5xs?OwM~8; w0L@osTC[IüzXz:)EOy!oٜf?4} kk=Ew9%;zZ:m"*@NUXDdת ,2tw֑W%B-cr#g]9av${&nOjXBWJ=|NV}neuRyup nB'58 ə09T7ݺu:,$~?$na^&A%{0 ZW9HhJMNN1_[Ft!u 9Xxں~Z˾i.O, Έd,eߴ*S3X ߹#RC')/9 5xk졞oqҜ4#h}6On: }~:mx')Nɲ)$ :G( \Ayߧ>2iYDw{Lߍα_{K }%hvXl/{eX|85LhESF|xe^d|P.o~ ɶn 9md[C6ܡ9N,(JPJqE\x(M6_(_*Rnh|ɦiIRs-Mr|Qw#%OE}:K1#^vc͋;dN={PvzH=fYsanp{RHKz^=-'Um+JPM Q%76.?a@+!ܞe}'._,}cؿ|(3iRm.jIi_FO١}A ?EخOKC ٔ-l|^~aT9ܣB"H/[u=ְO 85I̵M'veuW2}˗AgW=Hr8$u975IyF>Ym6HIjHK}JHnOȜ#?2ʚ/!=ϰjiKy"ڻ4_V0]1eu1z }R/eIb`ըYl,9blcYŻ*p(\<8O m<=TDe[B's;)KʪzoF|C-@RPȿ 2FmkwNﰋzd=WF{]Ù rÃ> o9a,UՃrJl$5c00Q3`l{l>vz+crshź'5|zsU$^oa4$Czh '|KowkqBzTTzoSBЏ;hO@MvMh94?1X6! b^?7>YSMeR3Vta1L)9S1{Cg#,OQk;¨?Յ.W$/p3qrAxGp6uf=٬eE[^bQ&<ܹ)`O;9]ų}KB$=cF17Yic| IFqMGFyȣ I(]G+O T&S0ZZלuOtkcI036kmSAl `NF.Z"Uͯ>}[RN"Hm䳞*rYXKŴrf+'gMPe?t {?63 V&@d.oˮ`#3.gƉ oM!c#iM[ >#XK$.5YU/^3O{<{U[1'H\U&)gy'B_litrVyn=Kp&KܶS&LsV /׹;$!4+#vgGtrp>"+x@k?;O Ϸny\tFаϜn> )m"ykl'GC9݂Mq"l/ *C]i.t2C@R#[ īNpN1Bv)PN"@[{ E)dp.b)y|&(2.?ұ)]FZwsȓEż:s{NA8Ɉ;Q˸YxDJ |bJ =}dԦy4Y3&J'si _=k;ZD/$8>eWûЁ2{CdFF_r"47zӼ`NL D'}L|9Ǒ~]T_.ݣQeP>gX5~bPhcT~(8C:,VlNV!fW㦊k$, "{X'MSޅHfy>fAr ϡ/`w5{Hr`/~)p\33 ٢a7dzU&qk7|=@.z oʰaRŵ2t4.M*_6[LMFsg['OA KwH|/`jN^@ S8+փRh G%&2L68`]DDl=S_4F ~Yg>#=t(#It d1FWq8D4*k7ƫ(u6_|,yg+(B{3q[-lV|[@TᗶFM:Yp x-i6UDeP7tvgJ+ab뿪 ]ij53U+_fWIMf;Dk}ӯ;=AW!V0Ia`#AʏڹQnLIxpkz?fg5,.&FT׼8X|ĜYu"v=7Ro*k+ }*r|z!Ic,p a>vt{Ҫ Nћ_)0UaإuɇE6@\kOegaXkkZ O=<]`(Z?5?Be~N'_nG$ @Eb|5o; 2՛j^rXlQ?EHo52\$ݱ2Kk HGW W}G~sGО5ŵeuf2]a/.3^cS,@#Gx0׾$"mh\ZEz"Z]بo BdG yk>_?EGjj[CQ542.7Ta%kOɓIFl=ߑwcDžXlDӍuƞξb"Iz)ԾciQ?g$'A쫼g; acwxӾ}Y~PwLL^',*(<$ml teaYP>zAO̸c+SIuesd.qK0r{4Y<̫h^ϴ{J? bIu礴rnDev>x:ώ˓2FMK5m;hoM& tUh!2HQ3n${; SnHc}ZK<1u+Vg&S,I:'8zɹA`z0Xrm9jxE=֟G+ /H:2uδSs̒q'D.h/8,jX=K0ʪb3jɚAj E:I2okȼcr b{C(c7X5WBuۂ3NCV3L)?&9=g^|wt1{(KzpT/g[WSUK3è]#u>n..ٶJ_"y?Xg Ɨ7{c\%4΄zKFXuo&84"ڈfئ"I<8MkYmbiwx4{mb`vLNK Sr꼃Nf<Ԗݏ͑ { sF\:1Cq.?yeE9fnP/%>{ntjgϰUq^b̖a2t:yWoQyYŒ ڳkTIUw-Ł]4Qw|Z09d)#L"1UPʨQ|Fz$cFfm LS'58$i8a8^A=.^ƑVŶ GFUV7зF׼V \0lIbJlG9ffh6v8a}FQC̬jȮ J(F7"Nncd)@lW {(~%?gKcurm|hQ ^B-2XI+it[apNĀl%[E u[0_k-CW}p =Xyl pe::|ozJ<! :j`Wa)zdB6 T[&K9f`72A6#YoHmƒvga߫R~Vi:\bm'ȃlg3!t"φI;҆p.SNuxrvKЭ֑HgBWk3pJ n6Έ[U9;o[αX$r >ޚ7E ~=ԫ.?ֻJ"`{qZjP+ [U iEsN^,%<Vk+Czu_sCڃ5+wLqjWL?;/s0:TpYͦ% z֮l'׾m =46iwTUɍ?F#L^/hphUqe5ѴƱvKʂ׽ݗUV6]wxhm;v[~Wk-"Cȏ+7]bzKw7vؔninWgwjT÷;U?3h2\EQlv?!(Y)$d3;ca[R:YD.pd䋉Q=Q).'Vm򩱡pja\D,_% +3ϔ3{ȇ*=#(@&@W}^ :)e9:,>%$~Z׶<hh;6*iSk7+WW}=Ϯ:(ndv`~XA$s/lkE TmEhοqk#arh+ZPID6F>oX]2EX-b,3hlKĄwR{o*:3Ze _#˄Oj/?yO.3ԗ9XI&A`ݟ18GBo662 . \!]2_ϽvDZ&[~7&ut4tj6ۿ|g<ѫ"7~TlR}P *u1Q kJ>sFLNB{!Fϻ:.wUEF|n&]g?jﭧ/KX.UkIpK+? |+fIr:r(Ou`CHc_74^n\}:D^# rqR%{V)<&;t>+~9L)CG;)Qޔԭn7ȯHDI"ZFC:i#qy-f!)>r<0m" lSRW^~{LTǫxz"Iw-1pD|sKr]ly[%(B8>5E MrՂ1Q,'be=+M<[e6ɝ'Ë%__Τ(00,GhLN;*f􆼻APziH=OJٽr̡֢mhEpɃ5s%+?Pכlu=TCˏ˜ ^ndm=%kiCL8^Do#Kk/%WFIe06Lj[>"_P> y;YcVWY- VԧC~Ɩ"489f Lg1wdeTn}€9.X^@- ʹ]@97?^z M!Dvkmf[2etif3sYg" <:i `gQ=(?DfŎf28\b&W\2V`)_y5RWkUil`}|z7Ӟ{:SY{ Fd&[@@Na_62#L+y <:ZDGAB=s_my Kw|$xfׅK[D#Uts@z&[^0ka0z F3i/3Tu| c)AI FU4m_tlh:3D~k_L|438uJlk,Idj-5b<14_b4=F8Й呭cpHsf;tR LgT#ɿu*{cl1rY7/2 tcQaux{[]Q}}D,m"ZJ`.+{Qp 7TBN94Q`>FڐCk dxP)ۜԥUKT\ob >> 9Gƌ0M mv0:@2 ba =!F͇|vF8)XT*dht`:>܎u]$ڪ{Iu D ]RCy dps7G Y.Q&C1_7"[w{٢R~)M}& &`5s9E2?N wb_-Ч+nu~hFStyPe"JX>uH>dT_[16pwy},kҲkan <{ ߓt Q} ϪQ| ;Meq%VsB|y =G1$#ဖDm~K X_*)K$JP|&3%1'gZwX1}xnxr&`81ѵ"اs*w+Vͧ%Mgpu_lJaZS1Noc(Cp^_NN#OoS6o&*^hIduSbf| }F#,MsIV"A0Ysɗ9YXw_YSbRքM#k.kP˼󖨞T. r%w- 7BmO pئl2_ VCyǢªu5+<?y}R~r); _,n["#êX w*[$0o/.;(V5c NX,Dt0܋uec~G{7qPx1/ei}B!;u @h2Rɻ]GpV9Um \ާwQ(77R_pU5P^!ϑ5^h`;`YO!A~{>֜!t|#KV20vhU9;dFdMH'8Prc^^vJ@A :k#{z8\Y s5#j5SPN-[Ë33<~p'&6XtOj ߳ V})n;b sT{6B$ALm./U)*[JҊR2fЯrjzrJZc_Gb06nxiەr|%BrrHBx i^p b#~#5sB- PL#AiΉ1)SL<#?܁p=AU^SG- Jd*+.EOROa .O>`\/D 턳nz25 &:V]ʈ^@T.f1s&]RE`TxHo4"e^0_IHKf\&V!3q$&fšH` jthzYxxdj8%2Z8 z_ˣ@Ђ58HY'^c kQyUbp]Y+!gIw&4niEJ˖3d s2nջy#q>ohܚn~ŭVwHEWf\:/I,cN^~b܂l@6@HIm*]5QgUvܐ.ܷYsKq ~P!.N?7WxY42 ][Y[PB+W)gps/Gj)>J[UvMy\Vb"!۴z0Q&,wGsyTQcJYܣA `TYb .&hK(Ӯ2,9itUVbҤ[uAI)Fo&jB6&\ au˱"+cauEea]D&$ij3+QnCCLoO?[IgkB褖d"|5ᔒ!TE`ܭU^E{LXy8lw6VJ" Fvz>;,a1u [tjΆ>"]4~P~NR_<}DL/i:j|*[T:ʍ5jNn"{/ǿ^Dl,F񡄢ˊwL-]2ySٚy!+N{Q\T>ZFΈZA\3Iߊkzf9kQ)'C-T,DU9ѥ7Rv1wK'3,w +n2[sgL=@v*$bIgnqP__v<)3"FͺW.ʏQ:ɟdpܩw?wm>{ ~X%V ,TWٶwOC;2l3S1V:^IsKfګKwORY b+nj^8oS޶#pĪ>(uݴfhb~B,*x$1ƃ0z=ﻼOH )͛zGEUtBj6쩽|Kv WVߢ/Dq$;u?zt<ځʘtYձ-=똝WfBFpF ۅ)vb`]۴sԜgL& bn*<ΰ 6<T|U1(}bzLQǸ9XA'+7 ݢ>4n*$ګu !__Bs^?JPZ7']wަ=J7e&#L<˘ml ,pcMWJZS\>*5P͕JВd@Z!{9[ ~F̞N^afH]o\\eUK2AΪiJ.ČzG1}nC3#A9Ĉ6ͬ!,gldC9M%*[۞۫7g(6uLjIuEm@!VdaU敹;wL ,2nGg J2:~F-\+ ]|̸+nse&]VhɤwFn M7ٝ[ P:Y)k]tO Ṏ)l2_CK?$ y\N2J^WZȦw&ߧ4 >y02m1 \q{1jJi HWy{N}yݐ΍dլ{c߲3\rg1|Ƴ􌏃1OֆV>X.P /g:gQ^r'q7Xܗ2 10 :k4M`),!{!oQ&|boE,'qf rzP!ĽWBs>'g6`,7le!u ݒ\YpznX/@Ћ3x|)Toz|^f 1/363ˉ84z%n&<Tڌ3 N=L֑wwv>ҪBW1ɋ ZRѳj(f?C}jdI ;i ﴏVMoҶ024U-dax?6FZ') &@y7깎봊TM_ӐJ%ӟ`] ۬Uw0FɢASğy?p?+}68ݜc[;N~ě{;3'x[H/ sCy0'Fq-\W졲\7Sysş*rnor'M1yȗ,ÚsR8Yb1TyT˜Ix3O<%ƦpIHenl5 Su> !`: \|v⸉/ms8‹9G]q~`C﹖ko/}"`jÛJl&U,[0;g*h'Uzr{ٌ>+6Qn*;!I噧q4]*J^vrV=n!C#Y \BR|{N0'Z7]ǢBT`s|;r{ăqna;n f|-e%纅 ^ab{u 7fjEE?^)x˶}%t;Oo! f -?3ُnB, $,F3Rw> ?716Axf@:W9WXP1R%l?Pt^pM _2% b6 'xvQB _';`/YmŷMȌ7C%]7|p8 oqpfh1kB`֙:cu?F|F9MS/(^OYy4_ y-[OvJ־H~Xs F J7V7$xu.c!9\ef4xgk&;Wcm8 ЯRÌۓxF]s"Μ=f;asa=v 1q's'gYp;fa}gU+- .}WA=Ku-"ɔ% BRXD )d9?)Es_Ff;%«3V|SEPp\Jʌ*c otL3i-rFXA^OŝW pvzIlAΌ U c^J,n!ia@t_KBxy،ԄQS0\_|Tг:QN!rUݹe*Q+b^)=w]t|6 c=į -[p3Z0rWqTכ=a߭8!]x|+̯^a[d K@ x=lglMy`bĺ()~_V,r+ǃ` ^',$tAw7 `!2**K?iJ`SY5:#;WD;Bښ{SڥkjBSUV~,IldJv-|ПAO`-Ob6sFok\z#U#XuSʲqj_d6'LYaL^py`6hTTV@>YaaޑepJOJ8̛oI-4nEX/w?@x `EG'졤*aG&eGJ/y+DyD31l핀5BW` ^;z*KV(wHM8/J J&qRF6S)&\.2#0 _+S(N`LLvY((6)OჸAuf{CX%d9l=F)U'| O(GTq~&'~rFMO-c<$أsU7B$5V|6Y;Vxgzv.HR:uvO{t3Aq_m!xEUs׽DJ*_f)&]ø(Hgx&Tb7Vu_TOjOiFj!u;3V{.x%~]w1tn]U7!G*TwEicuTߘ5[AHlS `n|:w#epoZ#wZH J.T1bӦ*囚XXPx/EgmK۹L`yٚ#efS j@<ʙ.h6K=Fœ]K+<[.~$ ՆzK@~U<5#eBDwJP[`(Һ% Mj>ǚ|suϒzT\|FI7X=m'Z&  eA;|V-&7CYK:j҄I嗕sWi/_'@~ H!ܶ|5]?jh[}yN}X5|2_aS$%%|ȢEEFwX6"b g#dG{:,UIk}TGu8)K"Tl"~ %Ę{<+4գ&5{C6K Բ+T"K UmPrYJuĖMtRVfK՞ohP}[.ty$y"Y9F"$:N-AԊYվS8Isa;d5pZu0zڲY8م="jƋ6|bJ &VEQ.\항2]y6ﵱ b!K]`؆'@o/K?N?Uͩ'}uph ѽY|, )_7-ق\ZrFBLf& |Vs: piTLP,*ecə&|x^صobHm$l?FF1ۦ5MKՌڍtK7q}Kd˥h%RmڰGxI)bѤ&M9MSYwT_OS q "=.Z#!yKm0owc+ɻrUCyrzFl gǰiJI4,7pY$x)oSBQkO4_t՝U^?ޔH;|%^uOlyEogDCjfA K? :'d^#hNPKCULw/Oaz_m4rײXNHqC*q&붢*kgnV-?1B7Ib҃G'Y}^UgNnkq,nx[wMb%w-e*ik aS&] 8n?^JWK?RD]%ԸN#{k<8U8v'YSU`w4Y19;)APUdZ5ivRݱK(mY3^ [ Ϣ>!툙|dxJR X }FWG\U^tLjC$qnKna(ԥ:/|./읤h"R,>!w]VbY "xP]R5Q~QƠU$q챀$SVlfQ;Voojj8Z$' ;܍^REƳAV*lu~ vYȱꂆ ;?7̩fQ{|\}ui!q{lV/%"0nUZl@n4jEl^Io:396k܄"uZ/]հ^/o@EOEo3Exɚ>h6NImg3xYݧ^Y":bL䉤~JvޏlN4/X9(.vin?Hcw-(`z:yb6خ7_윣YEØ(ls !dQ eq4@`eKhaF-3R(ygeyw-1Ǜ68(̒gkJW]V<]?"9NT[.#pt/RsAӥ"KKj$Z&~:DOhK-mh&9h.krϢLNƪ$fJݚMi/C[ߙOe[FfdH2_rৱ-jU^ݿ+Bf=f@rU;~o9a*ƶ{j糬ld?3_sīUb+Ci׾%TKi+GhM 5@63׍+؁koLtk8OM%KK\b]2=%,v%+6<гՄb{B5cfke AР\:?zzŽ l\ntl z_ pQm yTlV! J@n~qHd~fK:_XRRnfmh,xS|'|~l14iE9g(O{i;U-w6kV!މ/ UuHN{٫쏣iҲdJcwhqC NEfYE4{*:_2L[?^ϵ=VKj+BzU2#B GpK0 ^~]ݲ^z /&SPOG_^$IĚ -m?Jx%}~^љdmͪⷜ/un[2fNuQyZW~N(O[cNgv'®ޛ_:R߶ڥeO$I.j[~e~vM { P3H=l f2&?Q8ghї!ĒN{iv)ʩ̼, 3ʼ xުo !C,\Z#shEVayRX)^?@#SIoJr+[["&RWjκ?= )KFnўoKnt0ʞV/d&QVd} Y\&li K¦gݷsBK57p=1Fv1vqSib+M-`hkG Tߣ]Cv[92J/yLnN y^Ǜv0X,%AvfPv#ުrj|fT0HIfCJX8[-ӀqhqelG|yH$UΠ I` R s;7Uߘo/n!~RŨʳ}MQU{'2WJ9mdCMK$ GYMc· n$*55N? u-CJlCZo3A$1vcnKY&c+j vM鷯(mC/V WJ+ZV[:2 0C+u}"0aƞ`jwABd&s< L(be0Q`g/%ce6Û0'լcDB mw-33ؿ{1_4s  kD;g2Ӊ{91+[ځږހlc?ClvYYtrctLWsle.!7 F3Yә$̚':5 t. suh\;v.MK/*Ffs1Hq.ҿޛ"YEaC+f8\yUƚj5D`jZ7 #ڽo;Gz<[}U.sW-B˩@ l(zOزXm%!tcE ԚyiL7$%?uL Yc+S`uXCP9mcvVFh-dm8f8_>9YS?U&vGYڱ;6ShvTQ?쀟Ӡ .KV^nP]we弉Ib 6_Dšș+!bY 7?c6׊>GN)=94_5tQv $buA)@Rraɯ!_E)uZ`K.J0.ECά~)4@dŹ;Li*ꙟ4(%D"쥴Eev`#\Cp;G{;=͍AG^J_-VB13yQhUY^/h7MUFONxc08;G%t$mYS:[&cD_V"rtןgw;Y<nQkrQ|.Y6s3%krEtn(/X;\7o]9Ojz8t7 )Wg}sH"i^,|\g'70? BD'9LNDC؈UmVߨ4hMspTIV2y-Qh}2hS> .iowNnE-^HÙLmatg`Y~'WBw `75m#6קe]CU`{[I9ybL'bp[(gɎ#*J,c!`\lgdmIj[" GWȝ+9ӎbJ^dYL$ޖjG劊?8iM"4- HtViP,l(ҍD-V'{ppC=}L7M'? .\ȺFA"k '`Z=.Hv': V@`oUcX~@NЍwaOdq(6{AE?5 d{4@r݊qF |KD)97f.7|K{4PC25k`zW4Z[)?CH,!.9gd $PHz 'xlY-o [쮿#@hx~8VT_^mPtm yBKK5`>n|D6/-^H0}~RcQtJjl(P+^R^4wy?V0'f]O"~{{u9JpDq !ueg-C[(7{݁=ك$p@@:>BN-S ;>˖h'Ĺ5U`:m eݥ=gEbUEU-w& ی``s,+8GHK$wT(W^rW|0UTEN*\D"8:K̗e7]tϸ3it I1瑯v0m t/€3;aw(ιh)v(HJ.G{U *a0},.R 8`me]9s2zU ZtVJd3Ȓ`z\IES#u*[Ok}݈>k\ݹ<|EGUٸ@/moLdwk# jigCSޔ}ZhI q6H Jyza׬F=+Dڤ_IBavr9]MR(Iw3Ԍ-R f}J8+O&fr47uWE^_3arm|gef܃84: \*DSW)R+Eel_&mR_ai6POkXşOR-Wv (vDzV ʘ+OžmK,ꚅm@dk&!-%kWLJm`q*gY򿤯 Knֶ*qxu|[/AovL 1IW!KO86J.ywJ[o^)fB) P1_w] kؠ ğ<x@bi]HlyW.P?\CQ&_vZ`*{'!1ifllk6!m,k,ߪOo7[ک90YK/R/vyXnrJ|Q?e^o(<^E-/Xt!}|i1b>+5Zw#ɒ]™&7nԲŦji4.VTUTڐ)I#]m_URQH/ά%qV{jCo&9)y)bGz =Z2hCtCrQ9; !Vq&~.sv~όKuŴ~[x5x҄Ӓ@Zg5*H0V Vj7ˠI"<#Gq^Ɛš Cfq/mm-w> 5,h.dPo¿E{V?Xڭ#9g~r?d{;Mro].RUQVs=GWuA-m^+`uK *hX{[Z}Zz*n$,b[ua GT8L׍?DEoZ}$A36Ac_V .:a#GYfIN|ŸDRz;DB5*]s["V%OmiW(ܷrwZnuob67u#g&RH]Јt6tMX1Ƨז;CC׍ChگiHwZlpolJ|b/ѰgD<:d5ZՍ3sk[;s߶GQ7saTReski[K%~kvUf u%*B¿۾bCzcuEKͻYiPsj;v5-WTwɒ%l_Ol0r(򳤮kw-;|}F:hqIYd!O^dHDI_m_cxz*TU+dv怺SՑi5+^ߕI.>R4S/F)9z`.b61%cqٳhҡ؎c_i/0[/QL8X# @F*|\%Lԇ[_)3ۢWu=gl]Ӗ7d_zO;Bkr7䅤W`|lVt+qQ'`:5 4tr^;hySWEpL~(#\VFp(|qreȷ~ZAE;Q_pB)] ڢ؏%{QU dxF׽G/r#YaS3ƃiy#Q  :QiPǏ븛M UxqE+uiSRqL&qOn⮋۽tT, \| M ֈ t'JkMS+BWYri@j]IrU1ݰuKMkV4Lz+:z6FTJS\!YQer_򠕌H$+ޯwFb5C&}7]ѡGf0{W)/,Tϑ"a';Ʃ\J\s,lhlR7nOnr0׸r31ZU;$ݒ"x(|LG9F۾g:Ia7067/Yܙ6vY̝?Ή].-*!l0'p]Y/JQ K҄_LSDx c%#fOg\ = ,p]y92ҿ3Pۑ,^xLKdFe.6335~T dkTRW)ܻA!HMFhˤ* Q!b%8+qCy^l/CW9!׫.nWbꉬ2uF\3 Әe:%|%3G~kv,<&~NW_B*vXgjTya9XCB;e8/aR"/7L~t&hT<^{&aJ9MEZB,@x &ED,|d/-~´.z͂ꉫS;6 },h2Q[֗62.Gk {o}cɎ]Hm7Flěڏ\ZkV^S& BvkJK>fX0 Rؠ>wR%pNJv,g]Y5~5[Lukƽ%[hw.fNh e5FS<~,tSzϪ.oc篥7|ue6 />  9!fSg>Y5яvp՚ \[ ;ϊSE?ķ.x324"hb=]Z42ĴY #l?lqoJCy$+l/Y-G|1\XC.y]#ISy ncԍF5na)b'c$l0IiNW3tN*i)DZw䷪?-d;r lƤ{Bon(Z aop^klj0$Ict?X\sM˔@R`;ptQt0n gHچ:lԾzI+\w7% ԿL%pS5 ^Dp(? fjm2*GVhOt$ީԗ'6'[tC3UjEc)π9stbEXz2y`h4F=Bs+nojތf@~qf\+K]qq wm6ͻa( f r0"1\tscV'0y)=Tsg-HFhdz͠|K 0z S9 pkyb2CT.Cp]C%c[WI$?CL5dۭ/9)vJ̗pK!7dnOpΨnSƒDA<"<转l)x #ql  ^E87QJ Aa_CIHխ<^ՎkC/MmU[ +|*2e0|fq7S(|H$/ai'%J/Q?( A$TQ ֓w75z}O6" pqsGOӚѢxX葦'(z4PA+yݫs~ȕssx9 c absqa"\/ 8x_dY[/b&MC-jw͠>Q()GKm| -5xxa8[:3KPW?YZS+I7qpJp6q}gC xmrBѿ;amHĂt*Og1g.28L1e/F d3n[Kؘf&v3ŘܣZ7L- oF"!,TmBju8+- .b0~+~ *V nD>$[m6:DQ14v L3 4vAF/g!MHUrsAƙw+ p< e$_CRrX i#R_JHuDo% 5j2l]M61%QvOBhK83]Β8+ %cWٗTzEڻB#vk4.nK/@w`0l3x&jnCFU@dV(w˄b!( J"T9Hrz郐˄ǐ>/ j8€Ef㡙 [44Uz#;TN5\gIexw]IH唉5FZdx vmxx9E&nZG8{W] @⼸K[%.j3-,.iB"k K$7'1ȲO,  +%5ФB_RRC9Ls)ʉOEW XSaUHE_ PUԵc1hzfb 2*,}[/ntxblcdf_k dV-u`>^lD+N. M|o%IHn݄[7N`b;F)4^Q6K!;5K`%"%Ӊ^ԪxZ̚}CɢtrVKi#Ի.)ytTնOd쏦5*V~zm.RYԮ1P/߭p+CXPoỎ|&4Y ;42 L7$PG175G4=)V WԐu>VMz*. A|n@NcJB{ Rhǵ !GE}:e:a!Xc[2hV)_D)Ubы x#\ y˂B0xx4Il < ԍH54: ۪JV1vKϑscKaQH, c. ;^|'?1jXIUlOᆴSҟoQD3C߻bh7MiTyGgx iYrQ4(1x qFG6U!E^j^ئsWj:sɬה!bb\7ȘgKHpmZ:[4Q YZΖ0s mT*Y͎I$Bծw]vʥ9O7l;ӥ߹|oږ9wfCdi'*7O-B; D$ms&bj Q!^^ֽV6Ü[kSv}MRá]]P~v)AegmsUw۶״?oIZz|RHP.;aD14_Y@[[% ǍG!P o6djҸ޽i;MSjkֆ0V$/m&g/q1=‹ϥǀ3Vӈ'[@_|ָ~֖eFθc(76 kI>%avmUv ]ɚ&6Y %E[̿0KdyWQ29E}8)R vsnP'yh$]3?z2}`ګr s=R䱷Ot[2wX";*>gDw-m76/fTx25tN&4ZB$^R3ݸ vhMX^%+i]{^C4! RoB{c>Ee5AU)?8JV./$uBiW%mo^I)4Dc.X.C(hV>p8H VT|D;qWQMP,iƤY[Mɏ)c dqV{8[O(n2 >!9S[c4'͢jc+OQUdV)AlX_1#&I(rVuRzW"_? ] cOՏ&s!mB蟚UhY0ʞI4qaI^E^N$5'63g5t]%ڄJe@9OqM(+8CDqwcB[qWfs eVm,ÚktKMhB}06$D).ۨn4ΐIhX}Ar<Vw -ti}҄)^ߍ܇ j JmoJE',CĞ6C~ y}]J612;\XDD\f9zO 5+E ;we(Z-KÃe-Xy{2&"f5k~„`fZlVp vJyA)ReEpwUГvsz^ K@np$(_%,g`vm'Uo'0gGw:a'>_rJ 1#ɀ4Iv;1pKe%9\(@ui61xpi>`^vPi (Qk{{br=V $JGL@йLHІ69ᱦ?W'8>[Q`Ӥf-^/T-,nVe;>(Hiy_@Slo\#Uz;ѥ_~lWg%bϒNf ڻo}Dn@g#Bs?սu+5V7\R\(ӼR &z:{5i jxF՚>]M+Ni5ڊ-tus@6\{K~[$lGzVBZثoRݕ0 nwiڑ˄ľ35ćiuSiG)O+S\}e7V͘]ڰ\j?G4 VV5VD;Nu]e.Ͼ>+w1,ܷB-+ĢҸM)u6Tsi6 ` Ff5/4p|jmww3 9 Em8 <*Aȴn7 %#{=J^akG mKPjrflA ?ddD~ϔ2_vse`QBj?]h9;G<ujbld2Jұ W6L] LkJW&X勽#t%Ohs}ݚIFK ~aDM"j# kOs& .?m_GC}nA}}P_lq$ߌZ,EFIŭ#SC4~)~O7F v AA[:1MC1y*Vb{Z>[dEcFF)Tٚe HEOAW_#ƟXD U( --z:T9dT?Mw].{(i_mz dKoiR[a;{b_T]e}m*sԕ/\XچӃ*/:(bj69SzHEJuqˋx:V;o̓1{m3:Fط 7-Q1ƺ?.S'dvy=>?//nVQ_hk~3(2F- M*82SgQ|wnb90Fx~ϥZ~̵ꕍtQ j*>(uͰx7"7hlq Y4(5Tu rvn YLRi:Lp:\Ë 9Ձ6ZMY\QP;4;q$((89V{UGKCSe+W[8 uB94S,C4of+Qľų@9F ab{is("ZuYTMS֟S}dNE"Z::1 pX Trӎo 5<%ᄺ $]xzW$u#U[Z:,Ǖ|9Vɳ8;,dl863+ FiS#(LOZxo[[yOQ ԙWAs;?VVY?y\ƍ"z. +p8#g}يaP|rq:j=y;%{)bx/P"$[T7pmX=urx/Aj+ssI4,'"7B;sfVƦu.Lr!Bu,/0:Rgjw4&MPXzS6 [8kd:yAga,h/mDuih-O u;kU*A KݶE,fxgݡ d bQ>?ݳ\˻ _{$`F{y|3[>䆪ۃXGQbJ\<ep68{?%l϶[eV6,Ob6-myR{lby)N{g݆i umʏ<&TwMG2>67Kc 8Bc@/T#AkUJ"1 *9Z_]$/ΩK!NV- M͇YH`t; _Jֈ<:wkW?@`TZ6,1O5=3x3587.p f@/3釴 3,x4O"7 ە (sW97T N5Bd^fR G\J_"ԧo1c*O@7 0dc{V:вUBWsJas$k H -{y-A) a7̅M;.>"2$n2_?_pS0Aؿы?wKtDbn5_ekj3ـ: TP.Px+eS? *dIa=YTCX S;.4bRWe?X&Wq8Y9knМ7ǤEQLCyW71l Nw.emfZV3ߦȪ= ?ya嚛QVU^ɷՊdRoC1lc TK2E5u}+gˆ<٘PyY0N;ǿJhL]z<М?JMNiAz">d Ý[_BE5_ȢZ)̮(M7ijwx60/{ "k~wj#0Ux ?+$siFH.gޣ]İ*'I9s $yˊ%eoD-jw~ڈ%g,q+u=EkKğsAw @1҂~ibWd!It\#.wal )9PA5pҗ_Ŗlq$3|BV]T%yf;՞"?zcf|gPe8ʎsvUx%_B!O *CoHi"z#)ʖeEI|<|&*lox+)lW >1z9GxF7KKgVeRo*m{&[\q)1öK5𿵞X z?rJZ?IךLufX`TN=ΐrA)= E|FO$b 6*to]N)'CbT&ڊVœ/o3Qە K'b@{ 7._pcTֺlG Q{M_.PbҁclL⚂(-͐+UzY7$l8iAܥb8\s-r5&ZB_^J9 {IRHaQTx9Go_{&cٗCc1`K*9[Gm{}'BY(,ud#A'k R/Eë1o9sV/QIP0|(4 x#%@XoO@?[_ԃQFj'@Ί[ >#b :ƭBC^$>Gw:/GVz$b: ?@w:\VQwH/|ac.y&H҆Q%%0MnA+#e l&ckzd;{RKCJ$z|'K"tJ0/%.&PX32[Rڞ?ZI,QK̒m LA߉w.M|M :m>(sT9辱b=xڠ}V Άʟ7!?iLѥmCyxd t~ލPi {(iu(6 o9kBzB ^hs@ ,hR]J.A+-{ŗ͖1j?;lUإK|KnC|PR^Bqf_Rs)kn)Gʮ3I׳z!Un(܆KXK{AWQ>+]9ܔUCU!A <x;:Q|l(UP+ߔ s[e,JY'gR\> )gF>QSLſAP8^(|P$+ٙ"A2Y*#Ģ\|pMډI2|> KYR?PL_6@QMhiRi͕;RPˑZ!cd,Ґ5hD(nBؑHcd܍2}:,u)˜+(uA,)S"ړb")?\GMK5s>` ;R @HT̜Oڄ6EڢRmJt*YٌNxzx"Vo%h8lW} =+LXf\R[U ` O!^N%W%ø KTD{A?G<\R Laђ^nj5)-ran"q1zJ^UtG\5R-?#넬|0%]HE|O mOkanP<߱ɕN 2ϪY8̩$ۚ>QҢ6uG=OvRح ,I=Ý5 mT pUîULXPEF M ZyG6kM\浤p%j&Yp-EJ 4H`)lf?܀sNU}Ȳ}H:loƕ(`=:tc@nB^LUĀRH&7->S{G;{xf|Mj:L;559uê i_4f*"w6xYtVfGqƛ% n?Wv]͂E d޷Ϯ8'ŪՐkU=1I+7 Ƅ&^}d4[w`Ip]d"Rl%GR_eGVr2{ք, Ww?2o9h"3äϱq )~ 7ZD2 @G ^[]wc4jvK €pr<==#BO@ň@l.LcN4鿒Eo6e+B vx}?cF8Q\md?O &(|Io0kl>+X~9 {-ثa珊S""nAqT ~o{9Qк<-H(OԌ#Myנumxqb)&-_,׵|WZgj&$U6=z,t7~$ﴦVr%B o}C!N ⅈs7f%ٙG䨋hb]zqW9Mt);[reA+J^v쑆v e6HS -2A v~}<<ƅ#}][2lN B4?jU\IԛfG1RAצ{ܑ"]PihW,kz3-rݔtNbBZWR)W#&gPfXZ>́5ϻ1.dϟ8[k#Ĭk߲JϻWׁ\tBt*m^0EJbN'E^E)z\sلоNi1<ݭ}N.Xt]e$*%Nd)>r, LSjnvn:+3BISE0(Of.zCrd7ǶKwK7P׮3z;#Q{[Md(ݜ"6eEojYV$M#Z 2 n]u%V6XT̕<C"kƖҿ$.k,˼]"lnM %NߤlT8)SGW]h.!@2oު$/W&lR:ޒz`PW|Wg Nlok#ʹnY`;s$3W]V'qI?9{$7/u1QVk%}_ƍr%x@A\F,Њ+%*/?aeKLo) s)N/(fJq $sJ3!]=&yA ;l%HFxs"d!,0K ߙ{o5ne9-۪V M:CԤж&/7Kvst='Zx fppՂ{Vp*AlqAV&*GIAo,pt#g?tZ}uTY&fnMS2pH~jN+fr^߱AU#Cknqhۯ<@˵1Ħ>/zI1+EB[Oeq JmBFYX:<8c]FRV0kz+G;:s'r&Z + }:h &-^Y,J6sxB@v|W|g1JqVhk[-|sbGpo)ibG_K%e1Ь}A_pNG➜E^zeE4:ю3" e-CK4xW6U@h| Dc5[}O=V 3w 7q[tY##?-s`(|' 63{qw |>dpQfh+VY$C7?/6d:s#Ϫ] &"SaIRgću~89g Gc\a-w.>=%cp%I!jid CgU-&6v]„b=:*k5՟Mj apW]FBKcIO޷.-`lȄ+b0 xdk !&6!s0ekUkF9Wń@WA6I{#.[g7PXi3B [ e/vqFҪ!+ym E.)n~MROtbvU)^-{"lU bIM' Yx([AC׃1=;V1ާm╯U⻲g%eP)(n1'do+ =´x@nT+5w@wP}W3kJSI@ċ)B>K?# ٿ?u=B v V fxҏ .)yz؞|DSFҪ6Dz35[>uD{9 =[e,a#'Y:+$5Z4&mS^(T.P!_mw2v]OdJU_؄P&jn-1_t5叔5)}mQa͝j/Ld|7r#߲ЁPpgV-є!6H*,5)R]LZ/ kǺ_6T%dݥX1fA@u_رpqEX0]!$m0>UR@[Gg_%5SV\ĩdp ;~nc뮩X~I]k9Mb5ç%z5z&OFZ-fJt|4IMQ 0!鄘D*Z$ >+w$NCũH4?)ۺ"4໭AD5B`& :Ot 푄MiWR^[uXd5_y^x%Q4}*bA!&ݦ+kqnr/_vUՆpdK,ܖ9|^H0Ȳ3q ^ SU?TnVG#e!*{sHtGPNm )>Tl#i٘y (1KH^Ȱ TW'8S'( i΢'Z}!P&VtV֩}I X1a+zş=n`Cܐ5$WGqQk7ީq|-kfP0ި8N!|;.FL#Ҥ)֗̀@ZдNyJ֪NU3&R1YBr3%NO 9M0D>> ~QyOgD`'%S8sNi4KVGr=Zc늬{h(tC%ʷ!hTV|NF `@d ~ ld2r v3؎ [S!Ř$U|@c!Q RFڮQLUsF4O;ëԁy9QeN] 1`6`#E} ?…c`\l/.4kA B/wr_AtKnj1tW Hڇ%׸(nsۡQ^w*m{]Z*sAvPKL[/X >X]b;?I|Vo٭ՋԵ(wJtJrk3R^)XASKO d9bUmvY;úܢnk;V{|]88Mj54FлoHfDY"+FF)4Ó`~mX$f%5FD݊Eߟj꾇%Pթd7!,lWM":1PAu5HnM%zXEA~8#ɺbp[=MJ)5[{}p~4R [}DksCAG >` BN{:,/^&ʴNtu4H;фr(8f mww\0iۧu/lcY0]RSnG%V幍%֒y\|lKs?Yieޔ`1iӌ9z0?Y_w)jL"IEs MZJL-^!]eIMWg,A}q=!ho 껫w/N&J*?MT,:Rޤ<6e("}Ywup7h=Y<~,–N̗AGQʊ/tу|ȸrNrVzJ{ o5< -< cf.¹kO_J}WΫ Du^+ &v+=LgH ٩T]՟D=`5 v/7Y1"^g9 s4>=g#[4-AhH(z@(3˿or)etKppmߊ҃ךߡ{ 0wd)m'c![ݿ[trSNfG/PKz|.O;RQ{; mM.chCCډ6&,0#b-:8Q R&U9Oft+9Y@UpK8\WV*Gй??| j$hhIPq >í<;ra:*rin]9][(u43Vu:PhjJb)+&† 7|@̻}\)H"Woi.|YcOX$t`T䖉b.oHlÒE5ҏVy0onjx^ Df8&V*7\bκK.L sG92iPPbeZgɧ+UӍ̙\SS  ŎLiQy1x`Wzױh`Em.Un3/rqQ'D4g<0K>e#U lzL5VrH3-I >Z,y|dp V$IC:֢9ZitFCkHi%B&3s*0OK> '&{qI5s#:qpO[ů~Trd"$8Kw2v!yA$OR, %OUg%76[-3 SR >+xvUJZʰ:QcIhLEjcsO_[]p \̢'u,) `~b=3Nr/_FOD%-]u$pAZG9W^E21T@Y4NW`[ZPh7wM pg{զ ܸX;~ys KȉG2BོîlQj(%uH ,+[XW+䈟Һ*u52x+(('OU+ғ-ZbTA4~PDDKwrr=-zKg6*OP UOPeAZ΂GO!ɽSv^j,u2A~[Řo\`yUUq|By^3CGuJ lI}s?O{Ȟ8Zgt,NWʯ綪N\kQQ`N6i96,j32+(gMJ略.*V>X$.S*KrCuM3z/H)z&#[Ӻ\:fVa^|q6J lu ;M jwy1yXX.9Oh4ϖ>Y* %`mg,0/%3 L jKC䓈ZV> 8WuӚO)J;Cʅ<#XA I1Js?Lq sl+dCgit]T/XΞ/OIkWNE?NsK#hlTv:tHEEӒb͇yV0čG9En?%vD)7ȗҔ_GSl[71㪈[ذ^ ʤ6t*AvJ2L?G Lwc m+.}L~_֟.,=$eߔ4H7 7G):'yoJpbW8 6qW)nc캯!@$N4ƮT BhEOx)۔]P*CZtU.d T6ސV8VlT/_%4|[+ɐ$d ΂v/r[r+YXX?fLF;10+fKT?F "47鏝% kB!?9Bkl78U=A qɭzS.'cnvCFY> 1m0W&ԟ+TGMȋՎO5K>jĬ٨/x.O o YN?k7`yϾiW57 [vߘ{VJ(z]Zګ}&$uR8A/|)2*]^_rY%c~צ1t\pXFeK4.ۀ)v7D8܏6O}jt̉lh|;@-L'h^/X3vV_x |$z,T{(:R-s*}F(#&ua N\4#nE?)9]֌DYc7yo}T:G86H!x9Sǝ9~ aKy k"nj!xR5^p1iS49 jO8 Ԍ$*L@hʍ|%K#L^|)Zlو?fAXH$#"B@D#6^!S8#nd^V^eY)m-?R< \[r C e#2JMb_Ud@F(.[905k"3[,Vيx+o bP"r!4ѷgcW?*!B _YÛKpH04s̩@|Pm7~X&l,eʳyMh6,0mGw\O7g;) Ȉ/[q^`9D%-]S*D2EHeړp^-H??"WEUT8'IQJk\oWn kQњJڻVV?Rs羔& pH%I6X[HMq؆oe?jD-cq6y`aB.tP7d=V["I}Rr_]@Wu0҂뜩qT*'p Zq7I_:0xrMcj,M)lhs%+u=&(㉒ؿ2 N.B|x}5lVPr-ܚ_Mj4vW݌ICbpc=zxxZs:vLBTY%Xl0GR$+ġgP7?,G@iUH;k ">MvBŻWBJʌBС-H6⟁k<QCV7QƝ3zJ@+NbsOWY)lZdaޣ&׎ka ަnE53UYjǢlR՘2G>y"[B!q?zGzBQM'<096Tv@E(N_-sJhCPZTTHM9ށ6{xeC2^e/rS.4Y?3yrWQ}Ih4A|T*$ƯսU|a!m{̖&41&j 6nn,y)vvHco$5@g]|_e_,Fgߌp#:;acBAj`7'F3^8PX[)V^m) 4fxFMߪ_\ 5rGʵl3OKt kE7(gԐzRa:V'$_;I PVH|AYbPhowV[~=RrN s/iBC?~'qJ7O#yOs}{8Ly;=%-I<r1҃it\Jtw!:b ? #+0"g}6zaa~jlGD!ڣt1H: CABJ~5&?F\u&vG ՝k4Òn>r|\5uwg&VX3Q#86!ۍ }3G J&8Gd3K,-r1Y A{QB~h$ɳVS :Rvdſ@kۗpV[^O4d Dshi=! OJ\O NGДx \Sł=נ PgVWE{uF~M~E|0$V$=$ιZ0{%*nW8Og]4.MiU|m|'Yck$>ZUrA~D ӖW\J&6q"~MS=[\ˆjʾ6LJ0clezCʜK ui]lHxIիoM :ɨ1Mz,n1e/yҙ6󾨖DNiB/Ѩ+c85yMDž7!IRޔ^!*/}Lo:}B\O;+W:pNƻ($e4mT#w.ϕ37uu{Ä1]MB~ȏK) ɲn[ocGAmy w&TZ7WĈߙ*>U>Y|BȨ>Spkރ7bTw ەd*Fym]se?1Nt]`s'nŖa Z}:$TYmul%YS`tꬎkmW]QA#OVD7R3^+BƺG!FVkyVUz/~ftNԲG5C7<0lB_¼}l5X{8] b]:!Vo5@|HY߶_hB΋eE| ?K\ }ElS?! ڱxt>:`\"_`)|nV? 9VGj3U/|~_I2I|0jqW $eUWɰiuF*u &#=00kW,A?/X*؟UKN,V]d~VZTOk|.OݠZ>q5"s{gǁ ̏y-d>RMs+\Dk"]zi D 1oD^=Z5(J-獔PHa`'1ޯY/ }p'rkGF\n@DU9exLUY'3E4t玼܋)8Ċς=cBݗ8 +2p{&D!ף%ؓpaBn_^B"T뺻j[𲪶{ȕ6bΊVe=kbS\hnbrC{c\TTn.-"3kF8:悴#!\2"8_+IuP;Q9JoF}/C'^jYZ-a/)*CicD+Xyd4QϢWcz^E 18"qs*6k0jTz!&4}Jo夎[_ Aۊa ^jd +)y/">VzwަB=`,~ ޖT :` II.# '#|D~cH =ָ("K^ATsS|&3jU| /8`~5l+ J5d_ֈH\k^{yur&݇R}OY'ױ}RW!KuU!Yu<.Di_T>,2*VVTy-U/Hr"W0-6Ո.>2꠵^|UuVNn`r;ɥM+<+༨uX#j#&sV.3ZzRNӛǹ+G Tm%JiZEklFeLN:¯Y1(~se^ږerś4|WSS&{Ciyo=HuZXK_F*K WpG<\swjZ]|^ק|o2uJsis"pYu4Z\'KTmaV"h֩):_ӓIuk21UYdg(ܝ*Ztnk`EZG5b2D~r93a{2b,Gf۱~6, Cr'٬Ȧ-ۡLHUzёN6$=Β3J}]X"-qIIna Qo&5)EOә.9 F-;Fs5:2Ay!{ZM^\<ΓI#d] .NB7 R{) ɮLOQduIn+ekUO"긙#Trp{:k-]iE롪j^q ͲD;EUH{@b{GPeZaoUz󆳗Ǽq荢C,s( %dG[x;KuR"[tC{JYPP`x.MlQ493VImJ@0 o*B]IY|ITQ^7V]=Uxp3 0:!AU. ʫK)v9wDKGh8U!˜]ٶ2r\wM0^" 'M46-*me&ثqsm+2&0NN q!86W͐a`'o,ޟ_4rU@Њȥ045&!zw&<-mM?MK{)MS( 5.8= a"ѺC{l^bGTJo1xpdTë?T֚Z듶B,  mM.ߑ^UzZ}Ӭ ; E!2;+@˗)v ygDQwa,,SSTjvQMDAb#q5Ji쪬G6>N1JMŔE_TkUB=; Td]2lNI'`9HB+HoµP jHp7pGZ|WCl@褿*N)9[3N^7! |4O]9ꙚB;';gQSύrXkÆaoEV$_ m~&mo?J|*]@.\dqQ=}tnq|IKb6aNƩѧzMY9T` 1U RP2.BUҿߊʋl[RQ,iU5?JAFߑia^uHiD[G1'' [[:(j'e%f/aOp/5p>QHz?CN{Rhk8 $&!9{:DUяV*܌ce r4)DB0;"l|yWTF:Uu (9Eo6&l.vh/Rv)QRV #jUB-"GmmrQc Ձkଲ omӫTym@%RC:tW<vf64~KPU4YȺ޼J{"^$"X"ڽIb؆dI&h)a YΓb)yi;!b_Gj݀fh|E|E:7"UuK$HOMڦ4ٸ+~hx~]`@t}WOWLBZ[Ѭ3?^ҟF *k"k 6^+kGU^JCs3xNv]d~h@/cmHÏE9 eozUyld:|m}6KdР*}kZSyd+J~uiW+Sҵ1'4lPHSc}Lnr_D]q6(hV>`Hݭx@ғ(*%ۚg~NB~ᬌI%Pr,>g.j*MՈ=v870;)dF&\$&J-#sL՗aKӕ=46 1(6F 0xH;֡laπBx 8 7@nwCwLVe<|Oa*-Ґpt)տ9Fc[!q,gBL{PW5Fo$ #P](X~Ya:LP9PE|p FK cۣNC!p.F7܏![XG ZDlVɉfFRRR=ywԛ0V34Q Sϣ:ŐW 'P/"c:%iJhRaO/e{:n8 h6ԞQ$xJw Z sŎ;b_}C],Pl5.W ?~M7`b駉oQEc,~ M~罋 ӢX[DC(r\5cUQ@;K.UM'RSкgm%E-`dH!. R/p@5[IH.W`v\CbgSY-7PҩLY_ 5TQ<<VH6^QdzTrLٳSD~Lb؆w%63kIG6 !;üRhSo6!ܐ4,bvʖ0{MIJLlLw']u1|26š.47AcM)kNȳb;2ȵL!>M; $nL\q1s"1PH-!VPokr1lBN&%k[jBF0HQifxb&EjNL4doYO<,t&pY.%FROLoUiS#0т1H a+xb⃾7آ%rtsڟvIs?ޥYkfoИ$/ȿ;b ҙ~foIؚϙbMe_ް^bku4@;C :ط =oxxcEKPU5ɭks:tIjU?TڶvjY!iʾ6UsKy+Y7/o$D]jUue^?lEstX»9ojD^U |.}xHZVzEV7A11n/"&ӵ|1襭>Qk+վ7\d=o aa<>kuRĄ)>%ky$MoH΅-j|,[!QA[OeZ <8Y?pTRt M#d3WNFG4QN 5Uuu/۾jI0Գh-qoG;&[saaBLQӈGF40A Tv%Xz S\סUX6m4iS1!\-r⺩3NJ6T!CPzXVq,$n>1aO~1ED&mSrO^5-$ݩ T 91Yh\E^ S}%lyRk\5_=OC24EԬ+Q? tSznSP7s>tehT6֜i[\ h fNIabã9/anKa }ja銶Bj{93r0/_ED:G*LeΖ@h u J aǠw`3Bk/|}K]dNc*piVM|Uyj(Alv7vW_J^,n =$3^Pr&-?([MviqiTm I2\ɏ)9Tei y*_M/k8;b,y0(2Uf'ԐnǕKּ- fEwri^$mjҚ|{0ķoΖn+ TM]K13ucP OY+rȈp3kd/ s.obb9?+9E7n x":Ӱ } 4̐}IYsuҍXBxrfi؏8l.*p'b7Ud[iwܵcly&^RXgsdx݊t<ܼz4ws mOCY$f9ʖQg-j~XxDrk/V]s| hn Iܔ_ Y m7Gi)h9f^R5~7g\bHn3Y&5Lq(͝:QyΜ^j+VWHd 퓌xۊ9*U>2E3Rr-*+7MS;jfa/fIhO MNGEzcAVTZqt{Y~M- eǖ0sg2s+q>C6I?zHEr+r<׻(ApQnD]g1TQ)˳cx9;@. C\o; pʾ֮ɴ;Cr.HV+ d&5JJPIRq!T9Ǐetw"O(q ^b٪|Tū?fe"Q^@ :*;>Ȅ . y{ Kǎu~oJ9Fe%2&a,.\="XUeN=Ta!֜Iw`p*oTNą:03Qg!xKJOӺ-YqvDWYօزӨjPSĭ*!Ē UhJCvAZfnƷ<%E[>/q]r]<>sH\4V**W0M 9rd 17wj"IѸF ||41@HkqwivE&g.HU$̛ίLkH VQٚ.7O6 3Wx[N'ij55E|+TU +6f W$31բ-PJI.\TVe-y pL`\zwUιtn*}ƋK"Œ叔INMAV~G^\JyOPMJW[B]x9p&{N'ao(+αTv>rɐ(?҂||iR侦uP)bMQA-*0'"5dCtܯ*''CXu.bvֲZ:|cSy`aKrJJwnf90{\Y-^ҩU)S5;{̴f%2wmӔEV ԇk/Eh_M9&`+WU;p1nzgٲBVܨs)S*UQ;kSqιtϭ CcG'RtByeDϟJ<)X&(ݟ/Vq2@z?2H~`f aRvl1aͅ9al}Ɏ7\Ͳl?^" 6/b6E(ݭKuIz QZ!g* է;XDKȎ=$/"$3D: ]0/CUVL gϫZZ=V23l%Z6!ϐ+.)H׀zűS}`Q^8z̼:(7MͽNS'JԃVɵ`] Hby/XGU@h!㖪3t%TsH8vFց]WGK-h-,Qʒ&=U4wg|ޅ%#pS4?IDGo L b?I[lVG7^.}Er]5qp^Qbkƒ*.|J> ܧJ.!{LnXq*YQҥ/(u3|?Z0\ҟ%vثTN>Ͼ1MécXuU~tFmD&0  3IRMe1PDeuϱbϊP-҂Ce@Ӧq ŷTP߿^0hNJڛ(w—ӻpE&)S|3_fS@rg>(,c %+iwDwKtY GGn%sP."+}iW͂PsI#gm 9|dUש+8'bJ;Bb'E}K[] E)(ڑ`(Gf~V/l'wRU~4u->/~R%K(v+ָ` ̞2G; aiErݸ%KSe%1"/I6u=riV9ypy,t߭x,K$O)Q(9ءG ׂ% WFomUc4| ix7{b+;@גU9nP~),xPt֣.O fk d`_ggQyؗwKv_->!YN<5>u#;kDcYh K\nIΛ1VMMT]МIgj\Ac,ܢ.,8P-3TTbQ 9^Ϥ- -fT0k;^L7:_?'/*^Z({ UMդYQMp]wzX4A %~Eqk7;>BvEm6 Mt53Kɘ:-V"fw7I>[)T--Ɵ딋YV:ⷀ%2BI3{Ѣ|-қޑب%H'T Y'ivfietdU݄ αM]Grnϻ i:e !rSt[3vN*/ЈX|Bl!hdўGN^ ׂQ'dӄck-%_ ŤML?'qph rQbiz781 7#jY\"9_>!sɂDřxPԪr+P;Ft ߷qf'XW5R,kd^T6y^BW5x<* R|X|sL@ذ*썹7oTmb@~DYкn8z131TԌ/Ͽ[8_l BܮDnU=ATkZ65Uww^'O^3O\cMZN76{*gNd~֌6Y.m tQ/mB i6ؼS[hFj(Dƕ6ͪ\ߙ]  QCW,Vܢt9\Վ6k2 ڬ%yrN }ER#zcSИʾnto-X9;*P_X'+rMHަn-MKNf_R!GVvMT'}o-硔x CdF⨪=U*hÊ*TgS:,0{sB{#%xdC tƤ`$*ҝd'?XhM"މWE2?0Oqa df: BX4.w^$ߜyVFK˽PTʗKOJ= :\=5Vf]U>OhtHfxL-ȿG)I?~=9j#4q_@Yf([7p!Rfw㣶JPrvGHc0Hg¹s3 y(+,' xb9 "RP%F?^,߽MuXwZsSDADI<*=6!f}|'fÄ&ĝjq)1"IwHc:l >"&dw)٥M3:OW8C6*MTm >,9 Gj^)j; _꨹%|by%eu%Xk$エ at^a_S~[S8jKݚp+z횫O+ėGzr}Mw;ySr|-)7NU7MW->)YO)ٗڎ3}g񌚊@'|7 r(srGd < ʗf_/W6|G\qH >5, nE\n`evz҉P1E܂ /UU_~)*'v3K  O X?nK?ڮxh , (t01VS<˨v$}YPQ0B3Vގp2+R]P!r!&foy(0"A y2SjR]fk*u15>eB!l>"4A~(U*^%g*a\UZPza) CY٠/0/bt~3%Idà1 r KQB&j;)Rp><WY "C;&dtñI$p/ J=a+~A<0+ e<`` hIbF) ])6hKUDvu)a4:gJ՛8*?ϗ/5׆I"Pc'1ן *O םf*R]7O)F#1[nf/L71h;";;z1Bga:74|i9MF hh~P&_rw/&aUr6S x=4Ԣ8$ش'pFr5O== AA.<P:6=-?X3ЕC=UOe%Q`24^d^n烹Htyb7=vYZ`+t0S]wj46X   "pvB <*JD`PǦ {ǁy6Q¨}Uz1ܰ_$w/(ą Ca-1Nԑ,z+^H΋I> V ~(#Z*ݣ<@Q[C,Nŧn$vt*FóSt9oT$Syk}5G-/ 5fԡW_g6L<#Ŀ~-u*3]'K 2$AlJw@6EgO1o.YYU,c?ae&zeʹ\u.}NkngFKf`?brJIH{UWzyǿPk X33)@ydaЌ>#⟴V?.KZ3/bv[Lf5<4}8v&uSդf(!d U%ko) nsD6 P 1d5Mk*y]iph%?l0n4"lKL%%v",Iz&(*WѮr#p(Ц#柈}Y+<=Q}<9˺bw{'E꟮8-s#6sD|SMDC[b4h0`~MWn(CrDqt:X Ť{`<`A}Y b klّ&Rm'`#24 =1xgj'@o~? BbIr؊P-*Jpg*0!DE4Es4h+Ms7Mī&5ݦ#.ˎQV[*H,>b!sGԆSsEyRP\9nkOnOx LDW,dM{ ~ӏ͠ _ֺ08ftHu ̕nD}>ur=#4J*GӽQg&h%[xnʬANUKgϼ5pj Nơ@;>vpjOLY 42®ZQmZիϸH̭ŰD؉drt%VbT}̨9'XBQ uY!a F Q- ϽOInC僜tQvFdUmvzjQFosZSQ":'^mNIa*EMΏrֳŋRt A; ZO knw5NHl?XGZy)Yۘt".RLWn $Sf|3 =QTl5FۈL9oꄺ"l r'c'e^?Hݚ;'q3{'X>3Dlr`#ڰk kBO#4b(O6rocJ!\lw0s|#Y4gc T$܄^S6[hn1ꢩ ~j4;Bw:vРyÆ9jOgSN>f@`PpHhXxDdTtLl\|BbRrJjZzFfVvNn^~AaQqIiY9Ψa./LP5Ii:X[W:k/Xh˖Xjoظi󖭝]۶ٹk8xǎ;y_x׮߸y?xϞx߾2da9rԨ=7n@L8i)S>cSNJhe^_(? TWPT\Z^AaqxBTkZf͝p֬]qӖ]$($'Ϟ|5`w>~4o߾?=?l)~lYesm8Gonҥ~?}tf f mo_2 e/!? ~0ʨUնuwtf;sG|rօn=;:m6| aPI7~Ƙzc͓wWwC>>uK{ͯ v0t0tU>mnzG\?:sɽcLJvvm!m!? ?iowWts豣o߃م>=[ ٝd3l+}YD|8PDќKY.\yhQ@7Cn>X xxo? (|S9x.5'/=Uut1ٽoۯ~nŃm~$ؙs{OÁ٩9go';rp5}Dua{ʆem+o}îԐ=Y_ds^_ND.ݫ&o:>ӻz۽eq E/1c"*Xy 뺌AdMs\?5V!o:v|v~敾km=v5#ƙ &%EU&SzҌ1d(`|R$mo{룁~۾1ZTŅOׄL cFTQs?^oGwX@ӹHU ԼVϜvn>1mX:m\2e; n(6H@u ; qÝȡ]c(3BPe(ij0+}v `^((lo o o o o o 2^6PH@sѝSwn% w2Ë3GmwSF1adHOe.v,] 23ᔲt)d!jWXyw41@"g b@i\NrsqѲ{G}11%۹pZA2O$7{aG 3Gkg[ W%ko L ;1!ǩ`_іzFTdZ2)z͈aWw@#O!!9ߩr]J^nDڼsM=!NL_[Y9M$ŭb6/k ,x6~oBXLX!=^쩁aip{_'O,P "ʹ+ybeΠu 6M!۬F{ȩjE ySGuQWF*@۷X\ H[.]:cxyUoնp۩lA* ٠OCWo3Q>Lk ,, s/d60\}enUʦ$sΟvt˼zPݍ-LY{dоzg,K#^,"~2."Jx~F J" 0Dƀƈvn8|g8eÜf޻f!]9Er;fA)<-Ealhvdff29fθ:Hkj`a0`I3(o5ʝu}^m7ӷGѴ౴sӹz1;3m1t^5tP-jgvF|J==)"$J$B_3΃ߜ𴯞r t7:u-';,> jg7ḣ64O5I]%ݙ]ɝnbXҝp\}NOE\][>ѹ4qE73cQ9A\CKԡ=ױ3F)qDtw{_G}$Uփ%;C7 6z4jFqW isI B%#s؊$4F͘~VtC[p(q}PFߔWnJ6n5=FM3*f&ĸQSZҌ:l ( :?Wx{Ѫ/>]zy.wI{eK]MZFBk' ~Fd1טcFCZB/n_˾Ͼ?k}u!T͜A9;щ)9AK ZX92^۬~!y4mw6tk~<0_vxb\sNռa;jۏ6!֞f:C\ea9&\r_lO*ۗc`(ѝYO^ڳ af$'rE˩P5@ 7-=Nvw8gpJ5ku>e! D׏X47'c]6M-&Br˧T;ڗ plo{sܭs-ޮwm4yWE(LkpE쯯WRSysye3ᯯ s tĵٯsHU\Y](w :Za}JpuedAQ|~v0t(tV^(o ds35|Q{BfܭvdZoeKفj֣Tvp1z2"i>*).V=@zc@k:DlM|.rXqYTxaF>g]K- ԣxzlZULz7ݧ:e[-0/Zmc7<&JHr_F-*҅!cةFd B^ <0&M1\~Nj^ 4Qaaeqm$#f@%?ly񼆜yCH(;PU~훏լXg^W-ݤUݜݒYʠ)jI#1c܌ b̊6fKusrRmR9᯺|px)<$-MT̪fjIkA-sկpӌqag?c~êO'$럽tpk55=PΣIO\3W5WsmWty6ˆVfV*HWQ_~MwԊmtp6A9x iW-ţXO⬞'Xnk&Xlk'¶u̷ ̶U T| PyO}50e0W 8;Ee^%[~5kA0|tLlhrtpVtpatpx:c:1PDe/n lQ9*VҖ1ƙĶitx*s*s*s CTF2ŲX7^@%d:7es~qDD*ױ(r^(g>5a&6A45.LVJ&1$ɳHz,ݝHnWeaX,fƶNŧtKG}hJ_w-WBKU-ꍡav~pD]vWF.U cFӓ;bzX@ki>$㦑X*wCd=A0bn/E> *HD&+])i}* tbkxz!7c%._ejfh&њWऔ 1jC$(BFB2TP-lx̱<9'9%! 7 1B1.]X ed)HiJBF:ZϬƩ Ր,GpC}^szDZw\o&eZj#9Rb~PEVHi6nUu3,dQ2B|مwlF$}2Ğ&_j'/NHňhQxE~^hV^Xv.n,'?]5J 2@@00 S!UmfLjDBGƘQ.m֣86%*ZMM(ΝH(O`,N+&8j1dE(\rN;Y˧ Z+hI%\_=Y9UM(I,Q-2B vćٿjDlx8 Mۦ: O^MoKQ}@w 'd 03XrPluͰ*B;熻j{15;w-ֻl\N.3 v)lݨ34)hi14yP;~0B@dU @OA.`jL^5Zl,ʬ'\勶!5b3J@4&"a]^΄B)Jk2!H@`hhbB`)Yh^ە&Jv֠kCԵхtDuaz3:zޚNU_ ~wO^5wO)5z cU,bŽg'#ZCnAR )=/NҗՆ/nU%@ {CmݹAofIu[^M˖֤g6.t!P|[e-(9` )` QrtlҾ{wz֟B Bi[feYӊIsB(QZl~r{E-B |au>`

ߺ4q@2V{ y$ 4iM#~U+vE7fE?z(j$rol W+gxG?o18pie nG=]_> wy $zsضv.!t\ N{3?y$pM/\8x޶w< 6b6 5 5Ӆ(?@AoA3HPhtsM*ގįWQeTΒW.oɫ/xK ޒ7 7pC8_ސ C1d(p9́ )!6W )%/WǛFB 2j"#+P seu:*B,|ۈFVQ%To7[S"\ (E`:N0 F\#3kmWgخwYiq !͈^wE =%edYzf`jv`Z&q0=$H'_4POACc@3=a[/pRפ1r5KY. RPٝ\/TDTc @bIvn(pj> c.xO`inq^12J2[ڐezobiMʨ~Ly]T@ۿ$*x 2T\= Dg,SCbI`1v? ݮTC5&҃r4@) QjoXEz@'*!Y TyRfn!z,1iGluÝ!kH| _AaO+ л/( psghd]ltNn623_rm_FmRcv!ǚ~gFM(how%|;B袁O~p5һ/0fpwȔ#ْxٰff,ÓpixU¨- =pm7{ D6yB;kk^)kh2T 혫mIDe:Z[F36,f*pѢ8uڲ*j̚8 x+<^OEyWp@:_lkyjXぅǷ; (yLɺiFƢiq=#X1e\4Pߞ?iVnkæ=M3Ω8alֺaFaf֨5eR 9ܠ2HsCBB).4E `_;_7=z9Ӵ =dفNpNL†NZزnjA9kX6mR<q8L9:L!OjȪH˭;?}6K֯y cM2д*C]Ȱ-$ԺfDzvˢnAݼI< >gSf3Pf3 Uj3pl~W?ݿIjZexp(8cI˦zV|M7z r$b(X=4R\m-7f10ࡻx{SLSLعϠ˶m{cwmAAz@H  z @{Ez("V{EA\3}y^|&3̐]k1 5ww-/]k!.x!HCBuib`B*7狛U'GiY~ٓ F\#-o,U7ɛd5羱l}nݙЮ;C/߆m/ ;i@BKp6Sz`p9qm&-|'!c1 ޙL0'X[_v:\q%6 !hCD`!ZIq3|؏NIkA;󠂷̘TT^[Vy;WVm ;tvR0]+ lGBц`EEjAL8@ >&z9e3[X8Ί*gK-JްKضtv*Y,6D ahCĪkB H2xcH*r1=ƿh" +yAkg6e;J:J{\:4EyHPB6M y LpvؔC„[kOs'Gֹl++[*ʯ{*[+D 'v@ IꐮIC{\ S0{K&(x *k[u.Ci0[KUѣΣWYHQS,ɵMvrϾ"x]vlqOm(lT*Ts)$)*A!^J/4Tr26o&`8ןYZ[W&i.o-{Wֶf2Z~DZ 1hC4ڐ 9XE(&`f+UfkVOj,ZȳNf6KCy–LߨtTd$TM{MۯR.A<+:)wut3zpomt[SFMkqQgmFoK0+& ;JX!VuF ;~D hC ڐ rTV>7Z-t`ӧ:^R̯ItGdW*~CiPE2 Jگڨ4.&w[edM]ZaSaZ&:*ɣ?ڻ3"UǏ( + fjOC(ђZ'?S򮅤 Uu"f]wWCyxYuJvC~BsepkgGs11XËU+ik;ċ\%Q(I⥧t\'+1zdK0 oHNɋp-rjpu͍˫tLpN6$ I'!_YdJzv]V9M꾭o}8$j#.sl_jUήnik+kϫk{$ ǡXԗZS87GLJh?%6? XeQCY]NƲj42"Yf]uu즦:_hCҩmy\yb{vߝ^u'='<"GI°Ô Azu uj7ëoeToWWh/gvU HDRІ\ jZ0_\S1Pvk̅Ij\:xϋzL/X?j߷*6u-6<+4}[`:v9^w+!V(5[9~E~s=AUᓆV=m{mw$NmL7~C\36fG{KCm8+qY毀=+!қ?ɭ{8|fՍw}=0"_i?Q{8{R+L7 aen-_Yd*Yrʯ=Aud>vjg~/qNNTsAU?BUܸT}ߩF^b^/ Ɖ/ ^%t'# g+vY:xӲ+'7IrcxuSpVd~POb ijzt3 Fx+ ۫=5͝\RGsAR<$TABOt.HY3\h3 ie/[W/ϯZ @^Eg9 z,] sJ^p^ nj,ߤlHz_sJ:s,EkӚi4f(;pCKeHuK*l85㢞pR Nᬮ)A " *VլԾkXaP֪TIoR%H%Ymu{{S8t Nim1,H@PdT@ T%P*Xf>U4vMƽ6{f>;o536x h)PCtk` |8mgOtiJhQBҴQf4U4MmM|or%YoS cV0 gjA$,FBt h>1<9Y67W-8y:ELN.L;Sͮ$?KHv0ݍ)?h/ @|% DI±ZC0RA`c9F|by$LŤO'ELj2:ҞY]MzMԫi=k?O6HCDc5 FDS,Mx\Iq_kӈə/23+3fSSLlıxm|awN=v 9E]z^wakwa[WQ/A6 , KҟʡeXHe9>J s .nw,jv.itJ/w.*̭/uTuw;J%?? hC(K@<f Ⱥ io L͞lZpBx Y~Eռ ^bEknE[Uy{{yG{y.*˳<mOCYHSZ O%dR:e)iy'u >+Y#(*T3=J<ҽZRUɂʤ_OCС(r @kI-S*7R<45-313&8DfzeUy&  ޗk|jckckb[!X($JlP4W/򪆢Nk4NtyKzn{aJ27rol}ov}_e}_C}oc}oSgiFBE@_rJpgjI/ǚȺ(f} B_M]TQsZFkAlGeHo}@@x0';rO@}o@C埁 !m9 ' _r5z Dɧm::7 ]5&Ne>e6ٜTn~x[oW{H`kH|Kh^ 7r=#g!R KBSU:g?\Ƌj;ޥ=:6IkS].,c%81~-1-v-51a ?hC(sd&tzލ?9z+>x uHoؗ6zeך&TX%x::gӼ鑍 U鍗m/l os Grßi:xJbCؖlAHifG֛W[e;Uyղk%5Ҋ*VIk%;*g to6$_oV}=cJ;a1u:FE7F1W聁f}ey}iܤ>̤!ԸĸYY*(C"ц4P"sڶ.McezHcM8R]e0E7/TnТ շ_\7퍆h+'xgQ={pR-eo^0t?104֒bԟ(!z(]^׽~q-mվWTjDz~SXPTYP.( l %wڔ7齆w~ Hw3a3=j ~3eޕ{+C]$gX H) ARfY,ҿ;?+}xNkziO)@k.Мb 4m4OBӸ 6= -bB8q F c4'֛91b sڜKg'/.?5R ׺"mːip|{<wSpFDtipD4\2i&țcAR,1V 豕V[,}`)R3ɇ-Mk#aV8x #L8@Ԉp p  UAH)~TyФʁU2@FQ~6DdX,֭ym <ʀg းqE, gՔAb ) RZ2 (.'XmqƉi`g3X>lI1W&ۀf&6@esM'v7\**S]59AiҐm7s^߆48 h `sI Y DE9-@rN+[Љ_N_Eӭ巀1`xwz]njQٳ N7U5i道1XSr7?`^7B88* +āo_{̸wO 6؟: N.+ 藾&\ TZ6ob4FGcݎf}'vtpL m ΧυS"{"Te Jxݹ0eZH0s|͵xf>4eeŎeaf2iy+VLݭVwmp _8 Ტ* qZqxO1$d8:a߈-?|?yD€ErU˼~vebUkb`b&:`R㍤JjpCN !JVT% YK~.1DҞGZZ9xq}vֱ6ũ-vM})9S;sR~'C1=ɪbҴdf2*$*qq7p3ޫ%OȨuHΨeT9VeT:ud9_(vQ] @l L˝4UѯYZS9l*A)}8jGSp[|5;989.93[SҜvpNC/<>}b/D$պ 󪐤q7Nlns%چ Ŗxzd"2]S S{=.<7;)r szw]ċ2X)Ym8jt5iݑhV ,{y& Eq9E1EўEVygkO&w[t1xU${z"#+9 vs%:.():3%/, J+ z7 Β@AW6O8})wk!؇rWz_?wFWZ!rKY_n'2%]RX_w÷˷LQY ^hC(cMTiyqY؃fPRo5\J7.`:f[dه'8%DrC[GvBu複VVTöTdrGA1y30Dn k*έz*V+Kk|څ1uոZ#:,a㐾 R:-||~uzUq#yœ^cžcO5̜kٳj1rC`G cA i,#]?!eDzoe{w^\߳UewT<^I:bR;LrybfN 魦'G{5i[C1 ;U;5(X r!#}++W"MSGWT^ؐ?'?yNZ$bNFoNVuVd3+0U"*qg ;CwWac>;a>{ΆTgS\TJ*sՋȽ%ȍeHHr"[(r a  I3)&ỜsZanYn3:Etk\)\c.ϩOcܿ_L^.`6؊KMATvDoƬ/tKN.S |{BR/?_Π-ms#O]GLd<_5{;{Qpt$@|mo\}Ҝ-en lj^^ ^s<y>3xJB`6 '.ދ[bF<\S j}qszz\# )[(!%5{V,O5m|[0x"`=1aЯrq`6#A8A &5_O{赋)뙝Ø=SO;Ɓ~C&7MM+3Z̮,[ V֋ kj?@c&{$FsNC(FH&01seیsx7-|>fĀ+nVIpy}pEOpFu6Bl ] 8 hsf/H(c1pRb*/"Lq>]VAm°˨&vJx;?ު*u{xͭ*2"|ΝEmA\m3!B KĜ}%: $~?Ҙ8b l:y&[pODMhtm|tmVt]it}ct@t!g8:q8:i8&i8z1YlwC[!NGfR1K}0x'74Zqj]]ʝ<9¸[ 8_O>b%,T=6yi.,}|_i[(rGs`{T6'!94)INrHNtiOHH &ENhyh ⻾zUGEFF:]ƍU6E,/*31U嚞Z֔6!nSO}h#DIvM{^qA[}9d\[1.ܦ457?592=1'=O g{eygz\_-:Rŷn[iv׽*c7J% 4蔪TUa/#7!1<<%d *sݼr}9|,ϫ.A!ͯ˕հ4ajMIv sNe9pRK[z}{s}.WAAu b?KQnQn=MzjU%FlS\ 4.'1a* I,-7k̳eOorH>痼 +I̚ 뮵h^ëTe4fRkiOuHpJu12brq٦ YfŁ+;DX i'~]sqXC=ԎlVʯ'RkLc*JιQLdFkqz@=#.F˺J˾lv=4a u1~ ʏgV!~Zl_RR)iՔ,GEBc g6MQDQV̳RVT˵P1r%M p 5-AZ"#ˑϛd|=:n! "Ο.IZ-\T1YI|1hff @4 R5&i"PM_H\E%H$2$6-kV/8qN3& "OQiaA 2h jdi%A| dq0'<(V R; #2u˅mY‘t8&j'/i)9u8 1 i )PДUuZ灬uLDR p4OiF܋ E$uA",5y9lIa -8(#ᄄ t ^KrAV(ɋ\/0? &rǁ.) w$N!Kx` Mxذ [)Îò%E8|<?{Nȹ3p)= 2AQ`Da=E߷ 0'r 瀠$ IUP,~ JBet1Tl d 7LG4P|E[PbQ4')(ou>m]@ m>w }E) 8}m @ъ r.|L@:h2Y& [lrU&c1!cP|HWjoh3hpw:([ցޭ6DYB K*MZdȅ\ȧ3@ Pj0.SPa *& W&5Ľ3~;IE@G{x0πPՔhhaYT&(12֙-`Ԯ}Uǘþ4½1}ޤ?-=[A0:}OS"00 @C"0h57UyLWl/s5g>֌slBw q=.ǀ_`g k; V* f8u聁 uANJEk9fƆ?iij53SZq-\6fJ->yѤM{1@B k^8s"֚ߙ_h4fӺڞ֓@ h:)㺹oeV ^w_ X>&kez6iO!0'Lv:.)K'=id~fg\/~bcbGZ1Û6یP 9tt0#dV? \t++6iK{2?[[>6ڍQR09s03bXcTpnQqn8׍rzL8u0^;76,ʮܷNW7?}/Qzb{fol8fiɺkʱ񝆨Dkl>.&W\t1^0_Y/\k_U-M޻ xǷnJTmژ]ocnrmg{̅k*p6 r4wV*~Y9o`=X<|Q~Y` vaP}NFypׇ}ӍIX[wY;r[,?zV 5T[ ,rwc>6}h1w=ms۾E\=pp<sYֹH} 5oˍnvwu)gR kmlFm3S~Ǝ ݽ6@Ȗ1v|H*IУ$͓.7MɭunNNE~~۰,ĠLt4֠TdAAѠ8hB˞?:8/e"Ent'_!c:Œ ,fSS8INzXcqXcCXӵ(aNB~,muxO>~&I|x̖'JeLI$DkB}{/t wN Gpk=Qۨ;ܑ!w$G6XmG3N{-Q;ew(5$Qf&B[o/4+Z |\+q^T7vԏ{`Oܽ]H< ȿhԿikWMěsͭS¬]>>Ρ1|{D?5/Nt7':{ 7y\oX_ [ݫ!9i^HLcA"P ՄbGlKWGb/HHOl3l#L9#`68nvC+gO|Spg׈_%LTmLII3;fffdka q'[bRYœf`MY`_S8hw3fZpٲwqVLg]u ֋鮓X9YQ-_BĦPH9& o `+D"y IƑYxzTo=r($t(4vp߼ Bv_r'rirzU[cŵZYULBY?7f:f,SL\bhIJJf4%2('(e$'s;G_kkJܶk%śW!7#]'kTަx8{!AG92{ӭ%\B4:jF΋%g+  I٣A?!nO9됑ߐHOϿ#˫//ݟvs.CK>i"RxTY;ǠOӯ կNѫ.j:5zOŏ}~Kh9rvWs[g̼);kҾ}ZX+] fɆFu&Zm!n)<vv=g\ϵ!j-2*_Hk2fx%Rr$o'{DY- <6zod{An^fPbkV+l +I%IKB]w.Ajo,GBXQwIx*'yhHEPPX硞C*K%K1}>5>5Q^KWqyE.AF݌HHF$io '?8!y❴희[}ELi*4V4TB# Syd:UO?2 ׋A H%HHWğ;qI bًĹK9iM/ :*_08}y̼􂕞 /=VW{8T\v WjA$ĿY~۸vq^s8y郈˪2HcAA]0K!b@Þ (8@ b@24Ho94Arnǿ !/?V`[ع {wR!=8zR N`ഘ$bR )#r(R;rg/w NC$#sB=D ~ ^gm56#Ö-c9 pE8}<9ϝ)ѿ@^?G@Oƹ}`}n/8Pm 6zA?!K-Ya KiڍXM6픂{.®YڜN#pA8d#{d'ގm@!ܶS@PGOE2 rc,\qWm臊@%jx6H*pp8Rw@&ȼY _4>+c?~~Bٓh&vrA+ z* Oi6H%]t]GtȴiUm{&?WEsJu^sBmAnPٿ̩n^mYQR52(S4@=F@&x-\ [tAW°μ/Jڳʟ0_py h=^ '#xUI*&(3wy}'S[P,қWқWj"|U&|QϪ>`Na>LbT+ ]o;: CtwT$@8AŖM`^ɏU)4`0aY58ZNRԟVӛ'Ӝ!Қ{EToh c~ Jc`)D66U`FӘ`Ïj1S csɓ Z;vq+qsCY]¬-9!mGv`KBQXT3;cNz@Sj o"qIWY:EF/t>_#?!ꍓF 3F?S fiY>h&`w+0l볻^ɟVa(0 ^muyOu}? hʹ{~>6 mUF;Yq: =fp8ȝz-N @#C6udzOߋ1B 4M66H621I*5Alvm6`8lo¬hA2oMY?Z^6m &7 rz+/!sʙqMJcl]-=ㆡUP>8t+nje'ղvݲȲ}u{ ƤMy: spOm ;f|O(qAmo]X[( $AOqiR@)PZ{=uww}p?dk+3PF[ ^ύ\H9N;r8s0&}t[5cgYSXwĞ{#c&UƦיY^e LjɉC2X! b?k,?_Իj<ެ\, #΍ :Iݗ:_#"{[\CL\gΖ9r6LL$\O|;"w8w]%A+B:-e,6A39촧6wkE\dqrȊln~ofqIOʲUk;2F2f[3T4g^h|Pވi|P֐pA א )yBPWw]F{-nx@{qGSZVXE"{]qZUeMY ՍY]كյٛVd_2UVe_dIa(_5*ڴYmCVK R t3yml eV*k*-]Q:wemen[]9;[_=W_ĽUW̽]S{geq iKXn1+ |[O>ߕ SβuwNwڣ1ui-Ue5My=MѦM'17sosnqn.H@^EФK:15 :I:`=>#.91>5:<69S-d5dKkrіҿSo4qn67%.KRFZx߯Qy4,M(3&m$J@֜^g9:LZ׵Ѽ59SSUZߜPY_W-jS+`sLM7e ⋡FO,ϛR&Yt|}['6 2W DƱ˻3:R 9-ƘƾȦƈ #nGbj-B1@ѕĚ:M6f\G&ƙƑડxNVor^b<+&..&{rehꐞ!wBV]*,e9z+ sNg6n+] vxto5ofWNЋ7FF猱SֳsXC)EaC֕T05m, WRX8ai𚅁LP-e CǷ}{mx&  ȮӺۺvkvw&$΃֟GoUw Wޱ-MθI`pwۋ¸@F^u=7Fe [C tSwDwp."t| 7-GAWQ T\}Qs2谟ڛ?%O\|z< ss3kk8a1&8h h QD H& T9C13Mۅ8<ЮMCh9: 6BEyyr@X $X <d@M5A_ ̬M, !\u!LLTVh@މw0BCgZu ? #&@ e4Y9(*AM-AO 5BlQ[ܵtm5R+@Xc!9P7AE(1B_o8 : !*#Hق%H˛!(+遺h"8(c$Thq]p-2T;Up8x[]=X``Qi83Xaz;f؜pK`{^&EspLB6+P-4,@h٩.`GJL H`3.`a;qq;'#? H;MypUg}p5WwyZs#!v\7+w {]~6bfI]~Ϲ9rG?>:;gp~EW9Iא'-EpuxA<,Ha.l `j=~<~Wttss4yw\θ~! }r}JzۜkW p&+ W"LTNhnf@2%sιs7fϯ./]Gȟ&ݶy|p;5'n/sBOMw\dk cEՂ/WG ;޽Gr/F^3^/({<{|FJ~L}|:G %_] J,(KC DCD9 pN~KeS_Q|_Pi(+}z>v<y3F};}6}MǔWhl O +JC$DjHB $Z*I$j0}It{>ݧܥUkukS~Wv]8yQHW|"%62ϋ{ J:fю$̎Q'5=rkk k&ksMяb'?ƍ|e}_0+-!R QNrT=_{rCוV**ȪL2p}%&01zkELL){sLm¦I֚ pxT݉cG$ǽMZ!i-CRhp윩A(\Z_yȽz{k5nU+ "FRvfmIILNg&W7;S %\O[*']Z~hZPwu4j*GPn(>:)<-;8( _YR\WX0QP]p2~yb伇 Q"K!KTx6gKѵܐ:2Ͽ{A7>tݡmQ )YYU܊҆1e6TEVF*{PSUpA v pJ}Z]\'N㺼7OFu;ꮘВܖԆȚкuJBjV?* \HX B;x>>tf=:QNil0$nS{f:p]]&ޝ^ٖUZTV[l.bj?h4?iB@EPu#̓E6=Ӌ41cdh AbʹZդ~cb,س`$<0k(:2i .1?)#737pedvd {UV`셀,_U?ۇ~۶a% ]jIqAՌmt[< c'3F9|NʴT S6lOp:adߡ) y|DyMY?ejE|?BG7 g3] {b B9y>އ|!Ӈ|q~&ەnW^zrB{pfgs;ށ} b<˃P}qT@M 硁hsY}{.{{>HnIR\HIV:<"<%8?'vG_ފ{/ށ7`/ŏ ^IfQ^F{덡l37VzoM8Yu|kGxd>C݇|[ۏ566l>YZaa՗; q`/ށx 4BM*Њg(w9*˙?4)Q~kY::t4njjjaj;OɟPmdF0h`W!gBBBixxAH ą@v $=AMJWu+4-p2O-,Jz ڐ %PjjnAv@h PJy ^@X"HQQww);PUSR4}%0QKe-WVeURREEW,d@T/Ȧx#q8&οPS"^ O@.'lK[)I.h˩Ƀ4`t—u(, SJb$@҂4Ƀ)*9i.I QVQ3 b֛f)ΚaY0a O[7i%~|/`<]y0U %P+&XzViTZi#f90f,6N38޷xW,_9l-*H,UeB6RO.zJ5`ߎvst*FO>:~p}]mo: !^|o dj' Lsvn-%vz\\гW=J?.e=$vMsk;+>/R:tNQAN \qɉCDJ@\p S >1w+\oԓ&]$]@@B:OzvuS]}8k?P-q' eK{Dc/roԟDy dD8] HtE>_yο穀U^':8u4paaCK^){>ໍAp !\V%#` g½d8Ӌij!'R\Ì߃A5A-}Aݴc-}̳~Bm y?28C>*##R!KC+WofvR7ݕ. O'8'4#`Wh>}Gh9}{hckh;cKat$c*|c2DA"^F|gn;[Z2YCFBwm])p?w4a/)mg,.F26G0"B'"B7F6n Z6!l}ְCaWb|荙X_ CRH\ 9r? Uߔi <_tR|̉Bo2B]L2Fb"YeQڨض赱kbGNG{>+QLgǘo1혶e)*i`,REޗUwkԘ/9]$yKcwV.q232OLJ OȎeƮfWu:]m]-f=v=!s|}—"YP Bitt:G՞;7"<c{ӓ»SYI+mI-IMmI }IIcɵIےk%W'¼IJT1q! PTCK򼯖B%ѵftXpaz噕4Í pvh[F*1-;. &2:)2S2)K)M9)N^S.8}*&e>$.2?ebM2tI]jaȿAtG¦z@ekOIo{A\HcnkeVzRE:S)(fr:9Yy,.g_V.RvN\Λ\[ηSHR @ϷJa܃%Zb*itˀoOLD Ug!в6Ĺ2\\S]"50'+}EVANNfUnVf 7#5M˚d8917?=#}-KʭOvsGbX+/rs_s^f-%s%KНZtCG,C{y[ NH xvjrhj#l( _QN/KMO(GD*,Ώ( />".7EndșA"|FB:x5OVv3lkWE Y!YؤԘy!+B̪-9DzdUfaJ $C>WЕ}=EhvXmQF&C# +RXU2]z½s;RZ›әyYAUYAM홌uzѴ۩ork }-F&ChB[ǰwlC' &lE:IrMc^Z+Ghf%C u!v/+,'!IbtvUv%tK ޜs4޿v ))q>xU4#t v_?9s8b)ԲQfZ$(o]khOȠ`*7X І|#}  7U{ cx{F2sA5ZfM+题S7s+2qcf9dS(-p*AJbLPʘԩ M MSM(n{M𘘣{LfI밃vAMdPa]Ö"HI{!{\v}g#޳l_L_%T =k(={=^])::g0;篟E;`1TqFS;g$㜕xYR)S޶ԓ'C\5%<>:1QrbjA+IE{uFs\5ù*U*?~mQus_g`F{p~iJ. u ;EA<߂ 2"n(jR-k XFJzநZ ! %2*( =RJ0/n;ޣ5ROm"Dx| ~2,^ LAATAKZe4TFe(Ҳ@PII`KA4@=05{Z{)*#|A[,1el&H (K(,HHδ -r>`.(TLm5iPӓ-=91- %vTmo ĩV:hbA өڽ!5ޠ:@w;f*\V_k9 ~)}5/YT: YՖc ^jhGt1MuQ 0T`G1F~UnRg&?U>cP{o]UiђC Y0֖3E0WSu0 H-0J#6:m0ncܭd/Z?M7jΙna6w_-x[joA9h24ɀ X:lV]a:`j<t؀cПLY_Y|~7d[a];o8v}Eخ_sڏj?psS. oL8J^ }T%KW"":|t4~GL6yC5yXb±SS.'] L<$mտOګ]zܞ_wht2 .(Jv_1*}j#t 1}o5k=J ;Lny11hrc[Lw\!7Ljr9ϏɿN$8cY %Qi$i%6ICoh˛)V׽VWJ.{X]4[]tZE:i֧OP[os>*zq78%;g0+. 91#37FW¬.f8w8[N8[G8Fk%uic~ "Eqw~@l#ETB_ j_u^&>`JތuSwluM8|0 e@io@%iw`i63p i}>ẕu fU)3 q7`9 /?{8_v4E34=0n%r9${M>MN͌w%xn^)s*ss#skk,hGB~SBo}(0 B,՞*#KU*}65,'c/;cC 3Q1n“&2a>ca#au|WOֆEF[ο;Ww.x@R܃!+,_V*B's:VZe:G{u'R[١M UuMݑ+"7EVU4,KdY\B@b Ky> %Z"tn%vZ}=+mVNykcs"~MIuI+WDU&T$Բ:X% kc'b fc '>OO=z>X|g:vߋ+ao_o-4]">Xo8ؾ#?ܽ)7Ʒ6\I(Mf$W[krw$f&JH򁝙%.3k| o1$ ~=Sŋcbho6϶f%|3U_>܃!]AƅPׄ*j0h/Z1N+5N &E Sײh}}> 5tjxw%﹟ך/x> ΟCh$ByQYT;WjifGɜiwMIED !x!g=CPDlC9>K&_p'ox>m|4"tA6o@h;~CgEQu&sv-Oubo@-D!yl+pV쾽mmN\=w|p}mϿ;Vc,<̇dQqcfKIFuR :E;eD9D38dv8ʆt8ٚtkrH!3L1q<ؘx蓩_9ށxpmub^=4/J ؗx/, d*Bd#syU"Eb0}%r.rÕfmk5nѰvB}54/}ךx#1{j>{ )c Txڡ`lrfɚ>(cÿ7gmC( Bi87B̻<(([ETi-#ӗyo&mF샓GG?9O2TH~i:,ucbZ߮xpqCx#T9'B~EN~)XR[n[[跡 I?v"IUK(C"px4QYmٌo=u8,B_|߇ YRAS[j"L Tre0XenUTEB d /ҥ_:n|q~#/'.sgh!%:/KU@TX$D@VDDA]DtEDd i) SA 4 w|@^[ tG`e@\r@˂|YUb@3 J#4! [0$AvS3jſ}bUA HhI?Ȁ9ȃ'!*1&*yrPinL?fXǥhLK)K/3sZ%i?NwZ Nj|@נ.jҠ)Ʋk' Z,ZR?Z5rejw镝;&]wJvz꟔lpM#wo%_|z2/AaP֐-e)SC\,Z˃1I } T[ABoU _ 6d4 xD{w{dߚ}cvYgo}{d MA (U@_^Ld%JElnؚˁXPT~|3g)6OSh޼LEז]/-_X )<WxfYͬm/=} wmJ7A5]$J8)IK\Ld^ᇃ';wjl^f=+V}b_ؾQC Ɣnw)"QI}+oT/kEs>C2`-YQ5P;J+gSGC8{Nw5n9kpSҪ~ͥ[KeHI4ΓhzV͓~=J$0KjwnG\uOֽ䞭wH/* zg-}~[OQfO @HCoXEOb܊"s&[x _~ZZ,-z'z;z_͌_6~67Lﵝ?k;pvð? 8 ~~Q 2I^&%g%Fy7 `S SB$^O諉!z$qqqqqө?s^p;xD A2q4QA9&'x(df","CNLz&4,& 2I&ڐN׾!\Wlu 9rխ3{G;<ȋ x \R&})!.g)SنEg9n3ITxhLP$e "٭/'V*lg{zi ư'ϔ?͏  yqYZb t,Oo [m$to]_\KO ۣ3:ͫ=*ǻ-YSη.rҷ&r7meYZUGZeo V|yC?\2?zy $b]]BsT3 ҂l,rslAYWS26*=2/Bg_m_c*0Atm\wUߤ!?خ:7T흟I.JI^6</:6rt\?1a !ox9]ؿaUmnPB FCv½5ҫ)jM~5% P¼HNVbHRFzT<'˩4Fqzc#9YYᜧ/Qȴ"[ 7wW|hYmntlTUV-˙ܒrza_bFEĆą41szbsX9brE3rc>Ee  <gppl3BؿڥѺU>|u=4e?=h==`Fxf۪rqY &l%̐C雩f^L+M6m6qm\+Iӭu.[̜:O5qzgFiA xfppF<B9-Gx Df#H%)P{|t]D:I0tڛeืTI_oþ#{okyi;;c;p`o/B[q ؎{B{ceE%Pu^Ŵ3"nOi*gX*vgҔm(ٜS9ף`}nչ]k,?1}'֯b$4 FL%e9 QfIMc9 f{!ٙHfV#5L:""k@m$Oce /CHMns,I"!=H?-EVrZQ& ?(^bUI#w;~@8e}y'O Hb -](rQ"\4K?JPYFFɯj;9_Ԏp>_|T~FwK5"Bp%Wז'ZѶP$ZΊDSH4"F xY^*CF W6/s>k-Kk@2'܏::۹uJ;'Z g9Ots#]"PȌmu9*G q,& Az+0%M?[~'*e̒~g.p>k%W+y/^lznr@iO5.sۄ2!7|%Ybm!Klqnll@bߘ*2/{a1MES6']-{eY C3Q?D4:ͱ_r\*I:S/<sS횡zmU +7)_hSѥ|ޣWǠϕ*<׫ܮr1KzOۓ$zc!ֲę%6 Vb0M_/]n\R䝢y;W$S>UZ'|괎6kuط[oRaM{w *|YpmA/$Q ?jobtE?B|j;?NRՆ e#p{`E[ 77h4#AM> $+ b9`$PJR>MҠގק_e?" e+4d{h֐C'o 1h>|]hHXŚ%Æ-Vm ;l"'֋? ہ0b_O  q,ItiWӴlH?pMQqEik#l#mWGVخ[!j[.mTmDnP4d??jC_yިEzD?񡱈FGǀ ɂ jp<ǜ/Ej8ʆhUqIřKNť)z>L^qq|Ry⵮]nsŧ:wo|wCzBFY[yT'` mg\oő tْxEIi rO艟?ճ+ѳ3ͳ#~לAmq7^y7}E8 Dʛqy/ 48Z${&Q۳M[9>@sINIv~ZKWJGgxbى>ugL4% f$ 7 'KW"H~! ؃7N m%2ˊϋ<'#ͳ%-ۧ9P8#Կ!:`zJc@]ڔ5)˂MI\r92iPE_ DB"-r?zߑrtr.l҅UC2J "9g${6ff֏^45"dJz]hUЊae#%Ë.D?/NZNB _w{so6NՂ5ծ*_ytK"Zyi9فYe%S#3g2;&dGd#*/Ltn惨y?#2IXH,PgZ5{0{P[À:u7 :sxϝVnTm[7)ޭzB䂌Iyyrs*cr99mY99CrƦ県M˹'Ny#j\$>IXAu;TXՠKM}y^sjfN 5^%)u./M..N ̟]XQP?-!5VBrAO|RĂM &'I'cp7"S7?Gf{7+,Cv&^kP>D6ҼrرdJgAEvYFXZI^LRqq||񔄸⦄xq񒸘 Gbo_D}."ck\%afoD_ @l=mCmX5eFIYC턺8iɂĪr82.1VT9WY8&r4*(fdX+QXQd'q-sX:`ajrSf:gH'5CEu"#*Du auauaCC}4Kh` \{}3\~yt=_f.04w`xJWt Uu;#2cgǻŶZgΪ 2Բ^rPr7`Kg?&n3,`ϡFѽAFnZ$f^MrRB@0ÔQq=Qú3]>A]>]ӽ:<׹wt*ͷ㳇oOϱ\[0d!z`Eka ׬}_~Za,YphCa+<,hsx<Ӈuk%GbGkuB#Vǚ WXεY]b=<͜?f^h5sx+ }2va:xu`KW(ڄ 㶩B6cj6f6^A[-[D:^[t8Ux%GtY.k{d͑ևJ[|/kyX~<֦%k:f̞w@أ( 8yQz\=@P\$-.O_6O+"Qѵc ëwW^1/de eX85&aYD~ wY`&KGC/@(TBj mttgh*ϏӔߢ)=F(>}n/@A\X{)x\ ` fo9w4jtj*]}B%?%ʡs>_i/Ta*. 0s}2֞ kavw - ) +U Y#!E%ZA\T"I)B(@ڑ~d,noPy3(]to``}4?EP P Ф]pL"C%D kwC1?¼Rie(K$e GO eZݥ 5PP\8 *Xj %AhtB@ӈ0(6wo/Կo_)o;0p1_FGe [OHZ"2#()L$|aIX3Ι/MUr) w3w/-ORhNK]z@}{C}!GxDYW@W! :2D v!D.GdD&W$7)/әf1og|'Qa{oGo7_+R:NtL>kC/ 2aS!EWQ!JDSSh-;Y%CBI}Q~RyZ~Vzz|1BcrSa'Z%kx}T{鷵_3n|a]!:sEHa4ёcu1՗&&& d|Ћ~&R/LD*A,}y{F}̻FKwW1o2nd09¸n}%7_%Ϛ3&wʄHhcOp J[3V2o-|e<6Ko-uע{ۢReU3lU.^eA%!E68lr؜眲+yC6D /4{;]E<4_܍$_;8xܳ e'fλPXƻX;4wi&'9/>ZFC.{drSfs.)nw!J[ʖA8X;>Z$D('_UPیsQꪛ@{Y$ =&*(W8YpгAag>=^=)Zk6J[*m_QZ/1E4 bw$G+L,Dv'~ߖ}V%s7X鐯Xuo<];Է fooU U.V_'\VYc*Z+t .%B?He_*3_Elx%#jb w⧼3(Bck` KtV62[o(_oy eA_t` AkAߌ{@b2Lto^pKLk1,8{cۣ}6Fh K1\m46xyXҰj%aƃa3M:L-1 [c liOqya7̻^Z bF,;B B;1$SBHQi) |5qC1KM,DE E D5EVDVݢnE֝U6sDm"ڶF>nV$/_p= 7]# 2`WeSkdP0xقdqMWLܘIv1sbg4۷t8:̌Y3ߩ1SCcџ룉ӿ!@s&(7[uaxk\7ޒ,J߸ݞ(ӹI im9N-qgƖ4V̈mpmmsZĭ6v۴ScyT>}JOMվI E+ $+H~#(H[L|k-G=8KJz ,+7Ov`ztLџ1^d^k_Z1Ϋ4=׷8obZaZ}@AZki6f L: 3_V} {pwzVϵȊ*EbDYPeǘ[k+(7EN--:)7_%YYQ:.+4-cIhj䌃IB3^'g| L c p UׯX=oMӇy56nYU 5eaF%Q%Eq΅^92SsÒssr;sr׆s\ <|!Acyk:iAߎ{0 `QOׁ閴:ΌirSիV,&L;&z+N$O0!L\XS8="pNxTahš {C"&Q,8௠= }{6i@[i#Kz`ifLwMH񎛜]VYZQZ^6;8/(l80lw@H%ҧ%'{ga0cH,:*Csezcj;|Bqsf0ì(X$qSN-Z2Mpou\!q!z0ӚV™-[0_5-D754a699)#dFWЌR~i^3Z=zV7rqYEͷ ޏb7ctAdnρ) 4|u|GfAT5>̼{{W{wy7У烱ۼc9<~ `>E.(ZRVi@*Sj*;FJ7h[.t_%`E`yD}'{,뱼Y}? ~Tt j9-l=3hW8#=162<x 2A hT[V[.۾;a; { dޟk{pd;z E+7=gKiPzLM}iLὲHr_So6(oEoxý~ Vb9X{n~avf^p `uoc~w6]L}צ$! .ox}[:w'cs$l_vlK6lGOx/$?~nB%T &"(!Z)V  nL>Ȝ@z2]cx}{yOB Ԑ&*;VO(,󾡸">Q`S< @5 @3g~ai*#\aa*d©*+U g,.W[:7Ez§=OZB%$]@A0:W}"c0/ّ@UA"A˂24 *ZTT0Q7U{APvOP! :sv]ԝHov`,{W['8(q651C"0EbaYC 煖tV 5 m6hm7-tQk:Yg5n o2#IcPbo w^WItC`sXI %J-Uȉu ;Ei9&#'EDT͊h0kh5k6o4onYqrZ]w˩!?::Ytߣ<{3{ٰ>CVeӖs{;f$͌ΰhoUlUa]Uk]l3-Ӧ&϶:jmUʨcvQ7ˣ^M۱j\l Q&E92~m)!:3-ǥZfֈ ťS lNNŇ'L/Nq,q \ڏ- Sa(_ Qz]y9AZiF)bIU NeE.%uE-n/q=/~GN{Ngx⊸M\c.M0n}N"})mQQfPe^g[XZTTꙗ4+'+;44OO㝚x;-WZ'ϴD⁸iNcbg#C%2TZ&9sr~jSCt+r#M'em 3ƥgzeU5MJMLMHzy+!#<@߇[5ZX. 0œ:s#SfP(HdBhܼxnjTԬ,BABda\f_lf0&WJ] <+e<e|Aå1{Sg ګՠڄ8ŞQ[.UUP69PcbiAޤ(̉)InQy%BQ^_d,aCa?w;4=CN ||&: #衝hR3 ֆ^=͕3[_5*D7"4urMBis̤4\IES}BgzWxo ,>Xt#`; =&}8m;0Qf@ KZyK^]6-0&":>*%2=#iv _ſr_IGaşwξu&x ~7ֽ3W5!s-Ҫ[M)ŭwn,_ĦP]q8!*dz]`}DG)&{a}~~oI+{޵o5ljߜ?gaXz\ւۊՆAI"Lksiٝ.tbxNF6q@k5B:·§uwkw2c~&#^- mcg@C?}f=Ek{g0vpC'> `| /2ACd0e+^v~"4`^Wj~W+s?Q<8F k.4̎ޏsp-f\P {}Y@S("!x >x/,Ǿ/_nPEAC>|>"XǑõ6k.s888;025[ʘ+ԧ7+򅂰D;'n8_̤ \$?9 @@ @.$ ~@5ghO `1!x#&x 6]E#o~ L|<fc/p Z8#C"!&RBfOFmcV7^=,u7SO_Gy B+UcP1h q v8>!{G (Aa՘;s1o6fŜя__anw1\̫1%#I"&\=aY1;-M}KKQ^&SZ%4n\Nۉ쪙[ꙛ횙f37u1G2/ea?Zm5d#w=Z,'C qHl'i]۝#8[\$7u/εXrkשî%Wtmp p.q$ԀE^Cne]J揁X@W 8};X|z`hd,eIKdsez/^.{\yg:o:ߕDyB 0?D = H;w2aba0U_PX+,U/R*u s {;UڅkTf w OoVo|So=޵?7ǰ`m: Ś dz"憇5B[B2tfi)m m ҤWҮWҫ?-d~MFꐃSBcX̰2aE0o>U ssC݆*I$Q=@-:X}HjPeX^`8-Ĩ&|Qut)ƕ=&KL'7- gV~lROĴ8/E9n.9PYKtrےbubb jMDfE楢ZLbQDршUhux#q\s\Z8m{tZGTZ(=2m{DFnai]R߸~uO!Np?fn+y@\=89%Y& `Z%ԉU:SzbPi phx[qN(;-"=,=4{{H\%\8ftz)058{0ssҏtNFφJL҂*3jYƒ_+UV8Id".lV\8%%9)pᨽ_a;a ;a+{/?p 8Ȃ)mH#pM *AY1h-=+'{LZr`MqeAdEY$ev~ev²[aYlʷlo! %/->[ߜ{na4ZdZ=@E &5*z0~-k3S*q@^\YZm8-įf̧ܷfwMẁfWA=_W}6r$ƿ9=؃=߄+Ў4fYRӦ m6;V7vLt,Ő!j"-AsOS>iWSgSGEZMk5ݚh͸By_Z?s} كC%*ف5)]JحVԨ.'Fxd\_gOgWGGG[GkG)RѦѧ1ؾO mZ(fyM+z/2wwG^/o 64~oǫϏ*0Zial9Ų kdH..õ,i5ײ磔żľb w2{.y8 }b{.p, i;wP= Sl`RZ@?m@9/a | )GpEuz8uy7VZĚ;F̮3{qX?v@t|JFL.nn&71/;7],^ΩY`{&fOg0QX!WP Яc-rrP>Skؓqso~L N[lۑYbϧaſ`0;fw5lp 뿊`c&O̼`+Q1C^ x 3[ D)/>7}6et~MSt~'@@"l/(OP>Lx:-C_ `^Zd i?,py؁3q QY;c8@,6Qf)9 "I2}S^R1%닅tNWpZh5p6Ӛ :4}> 8N_G%Q8ļُaG%[1.Ex Jt¥ee{y]S%OIW+"M,8#]dJlrpD~o`B?SX{G`6ةtv(]*aF՟ 2J!rtMeR>jPQ(;8 CFLZyOjO:հKv4v6ئ;fŰQo5m;@YF>u;JQ|=~[@_h-M8gI9bNo@mEaDfIbOd6:j>|:uLڈyh,hC{h,ЗXޥZa, > *1nj%>Vmkpь'͔᠕1e#m&PvbZTljB*Ɛ}%c42RNƠC/sa)a簃pkKNW.{"9מpCscr܅ `>e }s5=YYYpYVs,t\$9md<~t7\~t'Z_/3?Kf6S'_!;Q@n|#t'z/>:We|t 5XdB[hZ)5_K.)˷ f 2Z  ͂& Fl|zR::Z^EGSUT%*yfE#F P,4,a sv Vh )7ī44dN/P/QRPVТ^Э>%`P2`F.g5k,uv DގW9RXJtD9sZ#2 a!5ZU*'khOn) ) -^;1xބSzA }"#, ߛ=@po۠x$hAg95΁$-P& VԬ .K- + /_6`BXAAl^!-aǍBog1 fJ ~s%Q}Cq,HuhK16'1'IWT'GiDE # #s"'FfG֙fEeDG.3Ohy<9&,9ir1Aqh+ʾe )ROu[19u^ʚ咪0hTlI|QsLQKtQKTѠKd爢e𢣎aEO9% -ZZ$4!$[O6s6yh}=<{ެM-Tl6 BԳ#ujk-cl %Ua-д}H6#AOUiXM@emJez3\ ?<24P/lA{;;ը˘*%܂ pĖ$Ȧ ˰Jf*q2q"37M}2ܧwlU/ϯ4mNPWl@y~/~Z_(7T-'Z;;A?+8+4ԿįطkȧkЧ됁we}7:h{U=R =DMDţ<Ӥ130S8|ѣ8̀T\]2]F]^Z[4݇j]Rwz]uKui/ҾZ.}Wum~̃DKFpG=+ɞ 0cE1X=!BE1^ɪjS%jnSS*ҩqeE%b'EN*:Bagd쾒d.!`&](|ءE.ElѠ-&ŖŅ\ -F ΋ N E 5  B:f^9֛?ZijǷ/0,&q.v)aexߝ~+X"&$mKλ]+, J4f%c˱\`[WYf+3L]L]^da,mVurrX[9+DQ{IQ 8jDfG$ãA c{tՐֱ.8:AjGHQR:,KCߒo:v m1aϛsq~hk0fX~^DI /ؒ))\#_H&b_#>,!$s_>  LVu`hۣ{ "؇| M;v O~ D,#OP}b;X`2 ;9hsɵk0I` \'B_y M̈~AB/Jp໷*isoedŔ!@-Sߩ~f'x=wLw %Ӿ^?ߠ{#]#bF 1G[i`W V8-5Dwh I}# Nw?}DFGDH҃ RF bB ƈqs8I`U N-8-ȫ y5B8X9p؎` AWuz V{[12"u 5n3! D^ ȧ 5(\F069D/)AO7ns:ZYKFLqd,.[V_/3\JG!pg-`gZ"LW&};$b8xHA:H2J VY@\czMH7EJ$=LOeQMOj4yv:Cg4ҚZ6:: :>ح/cd*ĔaSܧ}z z[OuyjABq<1ɠS&t´0ctĬ!:h>-|va8iV}ZuACj(xdKi{WӶXEקxkd o]pTrDZoxzwxfgXf{XV[XVKXvSXvcؐN}ؔN]آnM^ݪSza/ V,ݲPrr xN,h$>$dc]#g(SWYWY_fPoP5aXٰ$jŨ(Qa3;FG C-3w"-c6CS4aJ{SɾƄ(ڸxݪTò"*fӂuysf;Ͳcg@,tƲUi(LjmYYR^KbCZJuJfyrnIbaabI~BYnByvBEVBeF°ezFԄe#V _J2)WfIUF߿/V D3c 狩@ Μ\OauryfFQFn~ZavjiFJEZJUJJurJMbʠMBʴM|ʒM\!6ɯBI2&ELlUoJC;JDSc1 DZK,"w~y8?X-/7B'+'0-+4932!&.6&.:6*c62sMDA'2^> Ko&K۸gU6KU]!:݂~DհEJ4O CV;Ȍ BD~Qj}Ejn}5}*ҾQeMJ.}νgDN7DN=(:v;t$|,ץfx;{:1n^`R(rBכPz[Fz߄{"1.tWtOWt/PtRpoSpJgcvcx^٬k=zO\< 44 vEcDD]3s3C^}=uΕhw,FSWux M]vYxÚ.aYuvٜjٕa0[e,1FE :r7.Ot4&I}R_bumF1Lb,]2 {(d;."s} 2دHzH1i!Τq8R>Ap8k9bI=kӪcnB |>D{[GׄOV<#IU#)sbB1zB|2‚sR>`D'80`}h9ݍ5, aZq)6".<:]Bb,6ڐ1WP^Aa0 ?ε!?[G 4,v\}(Ep#OE"+# 3? PyxUn$dؑeo( ^Aa"ߌ*NWɯS_E^^Z{6!k`2ŀ)"K|\&/5Dx( {0+X7}h/p~:ӫuȹ\}nL< W ઀ɓ{`nC~|CC} bވ.70 o//@W%#Uxn1<[9CptT+gx.~~&kݯoAFXWS4@~Bg #߯422{|7JyuW >_?Iu߆C yGyY?%#bbPG  "7B[3B*k.p#3Mo-D[A;> '"nh/U_`1{t;?CQ` ^)854aӫ(81T736zq9޸NO#ʧzWвekڀ"IjSC=^1  V!8ԁBQ' =Cc`M3nK -pDU!0Nr'b2/|Bykm\ ^ N 8U4 N]@G<8E 8:1q 2akt:ȾK>^ޚd b0(ĩ#v6 ;tOtNOgetJXC'B;=CM!<oWQJ+ʯNiϴL?T{Dohbq&]UR:@' d:E N9Щ:ʹWnڥvv%ZKKiZ >?&9ߺ)S%;L/L-Wt蜁0QSo:hJhYNba^I͢,h-ZтFlH,WG-/26XdL[~̜˜ǚk0o`4/` v}AT&h/0K`-L{N/eZ1y;欷g˟+?_* { =u~AgkD5-ڢWb׳^E^wD C2Q#}?5.J 9H6Y1:sx~Q ~~ݾ.bQoݯQ!n7WjW[Q{Bi*7U*R z\+[Շh[DWqoc?bيS6kDc4\ u+t:bڂ[3UTkUk[UkzU*˃v( Qfa5 z7eؗPVA{nyˆhMĨh1 زzHo qcXJ]hjMhzUhzehFyhfihfIhVQVaFmytrB/d \'+gZY!U#z (3C;zMPDIf;q<1PhDtˆfq\9藌c?106AlL_W{%p6"5 mcd=S3M.ӎU.啦y+(&g&Ek%&$d&&'$%4&$F%̛F&1H8cIXw2 _i'vA x>C48zS{rը.ψrmΜlOAn833D-5=R+1-^?.5(:5$24",<,,uih&Ӑ&R^0L(0O$٪n/CsD>t kHJ-EBw~FbJ~JBnflNndvAXVqHVIpVIPVI`֨q@_)߬ |>'Ot٪G~mFB% -/Rq6WQN=3\M)&cJ"cBt2  k | |}fvz,|N۳muqϕl<8'hBފJ kSNuFVgHsfzk«C4}+3+ *=+۴<*4=*g4+wUPsZ񾪴;5?ԝKdr=%֎*4XCTQ"]oV 3ōjRkPnWlJSuoWukTumlU6*4nTrn!vn<.rj&rlxOѡ;CJr]^MmvI Qb ,A\5(ǘB{l(Ǚ{t ݺc]]N]] ]BI״s;߮߶Ymǻl`HW2ijrmýI|limi7,&8r=V (=8w9DIDnS\rR%i}L[l~LPtl:i2]4eMw2 zS;y'/7Hk+D΃`""LjbaBf}7{tApт %F~NZ MeL C$Z%$|xnc~GWcy7]v$Q2iRsmDFؤDŠ- W_%J8qVK ]Hpq6aڷn159ib3]6~7)~߃٘DdLt>3b£Xp݈<AqΪ6#h~w ڻbm+> O  s9&<f=!eP\8~ kmO 4 {#b䜁|c  L[y)e 4tbTmr m]Q8PAHEŗV5~\BTvǟS8qL)d^{ty5W`^UIQy|m{~k7q|r'ޙU{'x}sߡA+/i|&_Oq~D 8}H?1p1;p=C73[xzpZ7CC0 ><}_86e(`TQ<頗'/Xv=3,Ӵߏz =oG&gGDu?`('\w^ XSN2zI9ZI:Q$%:c4FOˆ;V<'C_jmo9}W8x )GG>TN+8]ȶc̀ yFw.HۉQk1FLk[nl=j r /N9>9(r:̨CF:ln1@ s2-qwh kZF4//L_cP;tS5>f 8qo, tHGiW)(ъrR*ʹ]UhIuNѢfZPA&4<ͨK4i?hJSI{?T=LmOai\EH谖 qݺS/%6 ڪG[KhAi~+mYA1 4m& z4nxƌnӨ4b;cHƴZGLXn/l:`A+f܉̽i"-bhE2ZdF|`QJS4iH-iܲ,ѨƈƐƠ ƀUF՛^/=Vd%9Kރ)v2-Ҽ-cލQD0KT$NR3%AI3s@ z&Y=.]Ncv+6-_p~6I@U},6r:K2b,M.Ajɘ:1ǤQi0{X&r]9}."NK%SZ鐶sۤV8Y:mrkp=«^Jok ? U.UM,Qr@{@,sҠqoSg zq<=aN~G#o(4z<u=ZQaFa6 σ eK=o*{~Xb=H=qvZD,kʟAc*4`HngN7P!lSIQR)TPivJ}žS"-J|)PH9.RL)[XFỡ%<߄XCQc QP= `8yuA~ʀ(Qy@4 M8 W(D F%?U%7_5'pjVZF^i/|Zj2U^AOq-BD$NHuFiQk)1ҎU!V{ KCEEJ!*ɪ9jY!!Mi!=)!c!5Cvk%Ԋ>f\ПqAU/:o_A ur%N⌨&ΆY)D)D(eFDǫi&j%i'ćwFDDG҉8Nx:ajG&[ }!c lhGI<8[K"ꓔ:Yʓ-ID7^vBz\RJljbLF|LvltNttndt^DL^x̰^X̌^H'tb 7NPCHIX@h*;߆x*Mu(݌YiRnz09_PPت8A?q_1ī:> }@i=d{212ᬇtxolJ~ U)ȀR,EB7nT0,?H᝛[פׯ7斷M5kS*ܷT\VuU9sLRh ihoTZ ~)QfrEJС ScDTCʽxeB0wiGi{ikiQ٥OɥtR\$v*=,r*XCW"IbJ2s(C`Cm%DVևeL!Qd:RH;2u<[m6Iѹ6[ѩTѱAG(]/·9ķ̳~gSߺU} 'β@PO9إ|Di70(ML~m:fF^mv”y9m\I[Ͼ-gV̳iZuqZ9l,,XMe61i5=\~ v سDXn"^Iȹπ,I/!~7M/Ӫ?e2Oc0M} QAf~>9O:ݷHsSsxaǡ^v;=(oz,4l̐L-x܁`ܟ#Hw5EŐ)B貘8L3T$^G"^yf%0*fK&(F^ ohwCgh]Ԋ>k0 فixH<޵G7A<ޏ"M?0_(|#qqE` ^˅ (>4~L{a| {^k|c>3u>Z݇q,znC߭5^n=5s1z'|?g їN)5`4Զk1@]݇:p_cw^Qc]_[F.<_sF`&Nȥ}Q7rk p6Ћhi BK)|O(U+[M!"4%`8TsԌ\:DWu N>ϣ5^h'@|mfu{":Y"7oG Dp2jPN 8^yL;:H~}I{7H=?{t2ko#7Oa0X1h`Qi# VB܇Ks vWs00·bo]|Ժz+œd3N898rr(-VX` 5 s7Z ˫WfAw#$CDDa{bLox~[bJLwHItZ6^1mU^--hAy}?Ji, M Ѥ2ޢqИ⏴NtFEUɯ%CL:h9RveoZR EWKj4Gj%Q6Ӵz+Mwzaט1yI#GiH jݢ~POՖ30,Ҏ~,owi*6CZԳn4O i & Rh h̠F iİ ;hhƩhzS!2@7j3h5-2X^nby% ڇ;oro"M:܂,h‹,i2-h2,s߲z-˩Dz,[VvQFFFCf \w쉞ÒAh'Xz7;εД:ۙЈcލoev0쓘v\f} ž$id5J:Y!VdU㰅]小]p]<}N;nOH7X}Q`䉲 w&ZLC.bvqbvx\-.&8vs 9S\q)Tq*\ڸ.RzntW$+K\|+uC"8y@Yx܈X&ԡO3F=Õ]˭qVG*xiR~{1ȽZP,y s<6 =v)dzWxF16 bC47M0B9hˣv? j3z?f3Ǔ[/z3r3D>]4QQϬ8g8RJoA_+{&z(_LJpA,8 zK[T.؀-eA@7n~ ?H'JK(%(%*'+lP XV?E5MT"~U}ɔye Jyh A,jjETCfp;Vn 7+ԓ⯐"J VJR T .TR nQP R ^R >|I=(u/Ղ~U (S h.Ռբ,Pq&SN 3#ډOQDD(Gǫ穇Wh7iEiFآqP7⢺O}~Q *S 8":_E \KTDJOd$JX xoaT\(<6L9$6V5(&E= &G/L7A'G;vB+vQ3G쓪1@_Gu= D$C2| ~%S}SDifFiv̘4ND'?4_!(9Tⓜꕔ\\ܭ<▼욼_Y|A%閒sJ ?+;Sqs78Si[PTŰJD I19cqdgs}Y ^YQbD%Le׬b%iVKV9kL5蔹O1C-Ig i?SۧʔNYXQ&(/~QRQl!"T)H-(H-|KaSacaCaPR)/\'+̷+˷-8dz:3uV2#`-䞆s .D_ QWΠJUjO yVڐ{SZr8Vq%<4meϦk]αXVlb[Taed}2-cR'פ!oxu<cfp`'ToTy4ȵAɩќɾQʰmfZ7,Y,\icӤi80la40O^ ҫj2tdV=`oA֗]v ($ȹ C:5ɢӈ;-ɴӁL:ɨӟ ;I+2I;I;Ic; H)|O*ͿJ}h/P|/P|/E;5V"..xs6 HgHHsȊ4ImȃTHy(C)8O¡juwp8[}O b|}O_i,:0(yICO$=37_"I'7iDI+bO:sғAH $$vzx=k:QT#w4|0/Cux1ؙ`#|k ]c#"ϿEfxQͣ?Eh<<( su4&'-J|4}8~t ưZ D-(!ıq@;P|toE!o&]b!]89|zL-CKF?wuc,];npf"E0Ϲ+`öð| !‡P6C1(chc?DA--<Ͼ}@8Sh|}uAdc`/8Lx. BsZD&O$" &b.NEqeov?`<4OCk/]Gk"'͊os^Fq x8DA&#@Հ]NðF L+0u|]z\hܰ'0 a|k, wp~s-Z̓wĀ>Ds=x̯sO[Gg~'v?Ϊ=~!~/y!5 Du^8L/ "p* }o>mC"etgxa`@TN-mĹccm1qʯȬcQ)a\!mdE_{ϑgV4?3xsKpN OjVpj&djȠz+E9ev4X!o+n[-3;;F`è fE2♕vrlf}!ľUd*t%#< ;G-9Β\dH^KInqPnFm@)6"N':Q!9[12'?VS()]wJ9qrK9uLvn7eKq9KrOt~3?>$_7H(Pzq{ObkqcPjuÜQn,rݼ9nlpnk,/5Ou+'U ZxIaaa([ n)D Sr /JfbD,-[=RS53ۉIx<# xt8| h&(^ pQ>Q9QD?AD2 b JiP^VQneZ2$d)'ϋ SUKCJ!`nqR^YKbO>?}}gPχP'^7j1('T2t)5̌BmqΜw^D ,8D!$8J$R.V U TU ٤G#==讒{L餼~P1!<{iQE m͈r`GrC"A ~"WDgDGd{d[5rN,-r<-rxQ9#EDNaBecoZ 4"6c%^1NQ hMg%H9^<g\{\5.M$WgW񧄒q c~PC.J&:Vp' R('( yt*Ӕ)$ML?͖Lล񤩡Sj!5O(IاBC|m.MIuЇ\, -xkp MGߙI @9kDVcewU~g2{{/LII )$ zw( XRDT4DVmg9WK2L9K,Y5i-N=NK8%-uJ\1a^q[bGČ+73{]6b0wB옱<uJeP5pO8zoT|B4LoR>M-_!-rxH& qrX~#5y:I;C{h)GZPz)c#ne,ϝ^,rݙ$YrY$ǝ5lyqӸRF[!f[~@g^h Ӷ@`vb]*%#[$ǃpH1#~A I~=H#8 ,`n%kGh.)F̓I^pdc)1=kE7XO=v+>W&ঁ ps/ BƎLǕ!l2f̳$Y=Kb33iqހ̂= vqTrD<.Ń iJp/ԝ"1K7RCau қ)o[mso#oe[ȋqi|<-00X9܌܆܎ܩm|h)T0|x IL1|s9/j`/ԭyK~ƀw@ﶯg_{!{Rk">iY 碤!Oe _YfW{%xC}4`WoIσ'ދp?zymvƂ|m ##8ߨ10X Z0ت7zzIt_ A߆>S&i?:ߏQN utyp tmq#r-AY-F-^C.ƵïXC=j45хmI">*]j8ѻGW+ɋv:ENI'p9r*;g]~.6ES2X`SF tyQ0&gY:p6d%iFz=X2W "w޺ΐ6f= ·XJUN=8m 8K@Z ,Y lgu;dXh0bx}Nc똖1;7a`&V1XU:ljv2yH-ckY=mY]av8\mZmvCFW]wD]>:u`ޏ~a2S.:䯣.Ѻ5ErϽT{=jۣIuh>X4m&uьx&ym\|6x:SZuxߩOhZ)/^2~2s-re<>xjov" m(ր m ӦviC`jmRZ]+k6RTZ򘖆ɐ_k"/9o{S/KL(ueWvhkX6hCDEkmDD4huDVFhyf#599-ڢɨDcWi4VD?MC<}q 76` 94ǻR(ekc>6Lsq Z/L|⛵44g5%,3&2$l2 %6 &5'1%lM|ܝ+񗖮?YiL8f\Dvx[&mdL lJRR4%4RdK4ԛGRZC)!sꄥ/u'm;m3CG9?ؒ]_86~ө9C9vr~n(D,g -Ep lY],Qy`~R=yٖBrZnƼae.uk\jTp?Zky}eϹZGײϑ%RdrccRdؤE/TOI:Mm<*ڢFת׊ neśJJp+*έ^o-n!q=^A*AcYe5kHo:+^xScE"ۡЩ¹޵ͭϽb̽b{~ż{^܊Kr*Eqͮx5M׬߻e}Uow=jr<@ 3<g;jRƺŨ.TYi)w,-s.qɯmqͫq˩uˮu˪Y58rKz.irNsj]SZo7\` +@ ]ij2yUSqK9!19%%y%y%esJ.䖳NIw9&6?DŽƏ_`Bf&cHo p.JZNWt+L]qJ5ewe3,]] )]I]C]S ].r:u%NKL7Ǩ/6#iY%Y )5S H}Rar+{ HQJLR`)y8Xn [bуKQs#LawB)CSh!_X΀}̝`YpB<еa) 6榤1?%)nޢ>+x|Ƿ*`bm]|F ;W t >|鷭ՌHPqJqSTLBg"< \ 68o靷)%3A~`i̾r .g׸3Q^GAz؍q:_ٯ!7ujacصZ5}LwRt/ !_X@nsnݕrw$r:cJyyN#!f_A 3ɖsvxa_wǾbGyDÖ'! $6P~x;^0/x=YG FY(uF`=ĸ%{sS4E{ .}W/o5ؗM0ؐqh;6hJJZ8<}"F0tOI2E yH:w`~*Q7ԯ^78C蟀OW7 F }F`\oN?EpʣvpeEPC¯M/#4$M?U_Me~!d' ݕH&u$R0+wPҎ`UF0:ݣ$gHUjݰۻ`woF[_SFMF`Z]ui͑6Ÿ0|I' bpjLt?QZy3tϕ`c޺u,\3J޴=8۶==ajV4XQ:bdc%t; .cWȝ<: 9oerY{׾: 8 ^(ăN!UQhcQI0fY2s-q'uKu{=ƥݴnA`ǿ>g_IOKFS68Tрm`t1@Gg5`lDz~S۱~Jmm3={>F>'zJdX)rն,z!Ek)84ӎ=` eg8[ѿW-sgiZC2nYeqW"Oaf~L<>tft9C;,PؤMwaw:9Z[+\h4r]ДsZ3-uHnC=0!LEaL>=I]-@[ݣ#Y󋲵aQyVjg,nj. %Ҵ*Myk.Mָ4{F}Ј}[C~D>GG*c%|dO4eVL hKC5iZ% t`iiP&4<%5^!;4BƄ^zzBPF?+sAn,`z;$Evfۀ]keMVj61NJYDz Y9e]TuSASNY?t)?oN`^L rgLx;F~^uV{ZrCԔ$SMn2'RSP[XTT7T7픟)/"N9W9eSfN u@:YLx.J"(P5E,J0Kr,EEEEENE9C˜:gpJ/9\VrSj)ů;RW甂9_ ƥ`5QyL#cu!m)wSe*T\ŠS~E9!1))b)rSJI+8$VPC|떸>u+c{p"HUAjTT祂`E).Qu>FJ?~ 9lB.g+|n[ v& :divBbBT7C7#mHx,m= v3 e4Vwk0nxn= p;3Ď <dh܃K?p^*}Խ?YBFin1s֓; >]!#q c%qq $I:)O$8A|)8/ExK՘[ф0^IMbZAiT#%59@/  . !_C|˾ E;~?#ߜ~r1?O#GR`B`g]!qwvcx0w$UHa/`9N:zw_ù߁߽zS 1 .LvƳ'4'ֳ' .C1 u @xx^߽*4{fD aXI8֢>=`wC0]w8mm /aq{xx@`N:8y`Q0Z" cYM³<l$#6=1hu=9o=v1:.qc*O^$Xh20j>I e_ XCz%-+fɉz cܜ?$CƒOIr9Գeف6DSx V6 Z1~Q;k pfѿ[h&MjtVc۵FͿшXo,&~'ǘf#vDصYi!NӴ1W˝5T:M9hK&]4DcZF#n[4OjPqz0ͬYlp2oMhI@FR4B/V=ARg:'B![MFMua65ՄU!__bJ)9d9x]c&yh(,@a OPwx:sQJF49]M}jGͪ.zj/RuUƜ1Uj*~T}SioMQ"_oSȁ[iJĖQlĖu3&Tm11jMVSlc T[ZSM\:T?b2%5&0'6%6&b.HxԜ9/7_,q\ w  2#<7m=ґDO5'!)RuI NJSeR[x߫rU`D)?'A99i\sfn%#ƒ␚됒7搜’ْߒ%>&K\7̱y/!2!6Ɲ<~m'K/H򳢐ZТE- PvQ2^bJ-6%,MnK\ɨ%d9d]]rUr)ASD/Mᅟ a9 >p6~5BVX^*A(ӳ]^Ԋ%WD+2I񕙦SLe)Ui1ET͘«6ªBN*W>"PP'q7-#H#Up.J<[F ܳIuWE+>M k(UhC0)4n5\*S^wS|?7)6ぎ7ވ} ܺ*c΢$Nmw4V?*-Fm h˒[|۪"~yMjQۜvʭ\[ʥn9<+7fU9aրjiҡl ХNz˧7P^썗Go{[.9vˡw,+dPwStC:F񕏫 VxW >&_92-|N4BÎUD~n5 i6.U8 5!%tȾ?jqxKx.k.;n M{8侔Iw)2&eqR:RwνB29 M@!Ic/Q> v9` I#(?|ig9 &UL<tW1ح*wUѪg+=TmY*ə.~"ؙв܈Xn |:uz ~~ nޘ&:&:O[/E6ؾen=9XO5}-;tvɄ2UuB IYcvĎcv6mۓFC[^Ds!-`War>>omf605]Lc¥=:KߠMP}8Mn#Ze63aU&츁zP0nOӝ[>kR |gPr~`EF&ED[=[݅>t{S[Z&""&'a'xq,z; !')~9bE01O0J_t!Gߔa9dϮ9Zj -,Zi]{߾r:nNmSA[.`K8`G68ڀIphпSXJ3s-Sh]J4'tڛ^~||M gW2Px1E[?X`Ńp21vpzcBcjʌ02Dtɉzs?L4nBc̺쳋v3@619^[cq@"J+\|(:5lԐy@1[fkYv8NpP jVOucmG2DE8]Ӕ'S..Zq-qшs35蜯~T׵AݮmrUۨݧV-մ]ETj<Ͽzg m"lkS<1l1k]qJUW: ]VZɧ[ê]:5ߦj\7AW%~?W':M)ZZ8Gx~0[z漏`D% QMjU}`jTԨU,LaKQeX T^҈:G(OʏZMʉާʊ})=ymSzMPs^Ȓ$G7ϵcK 4bgmU(G'0&M1ʋ)Qnl)'ٔcʊ5eϚ6RN3%gJΔ)1̧пФUEA^[yu).)6ZSLʽo8`.O@CUk,L3)/Ui>L VzzRa2dN֙v".1Ed]c ϼGa*4MwQwPQhA/҆4)E xd8)5gs8*&/GQy%ȼSD^)<TkSVyw+ [r>R`M΃APҌ"y w)ӓ -/rWLCYdd)P%U *iQ`IK&WF;SzD%Wkqɝ,~F~,ɻofW5o[jG*CӡnIp_ Uz+2HA JU|SU.FyVukQyT[VVKi9W&'T+ײ?[ l{"P R[n&)UCW!y5iQC<R֐-׆97ʩ]GKÌ /h`VQ)վ wQ;o)x5 wTU(tB-k6ɣU.>rjC{ 2g761CکwdV8E d߄ MX~k@5 ,(A29} {՝{\de2ccc3>ap_@I/$k|*D޸aڸƶTi&J/xˀdf022//I-..V+/P CƆE#6zPR v!0g:QȚdr_J[,-h@kti;i><=] r8 !h~P7҂Ԃ]n[J4>nQPЙګ(zVS9& t¹/ޥR\ a]E^"/W `Hq۶(m zMr55)F!c&ؼ ;avrc~AA[lonn1|؏BNlz[=;ڑZ19x˝ւe`\k"{ȏba(v i8ueuq*s mv99h|i[X1/'5Kɑ)ˍCǕ ۹8vB9dhpԶSiHer.E5H6Dz3y u+mq^L݉|S=`7]v&Ɓl/gܨ,~ l6y<1A?}eݩvb] !^Z.g\g\x.Bh)J_cIXW7_@}O|B{E#Uu߅C zpSB'%:wa]߁8P~;Il~;NAz~'9zƉh,o1]I87wëޣ,B_7C[I.d݇1qtO+܇qJbrZ': wҍIwz +-tK8b쁸ߚrxa}cџh*!E@m01^a)8뽔1bru [w<̰b#FJ7Y9 ?#Н@@_j@Z݅>to\``{@vN7܋<ϐsU^w]}8DN`x?OF[O`n؅;ر;_7wz{Z2kN?EĶp}ع>f0܉aE E6D jm@+ߏQ ,3x2M+gSc^ !ˍv|ck)b3m1xU<i`dڅi9vb vLc2 w֘!2sZi"jdcP@+V14Ti؋H32OsFɌ-=Ng/;%R.jrIUk] TZZUҽG*Uɢ *^[*iRoF7HYǔpT7#C~`o#H <׌= RG8S* Wq@ RV(;AY RzV);zTW)!Ň<*.UG ֺhht{3aO5W`KiIEn*U^hrBt)-T)JhSR"'FqQuDQW**vEF>("}EF|i`w)eR iz*׊yO>hOG(5:\IѱJNQBLc[ظE)*nBMa+4BoSp }C+$S-`wzҟd}CjD,$-w%$*.1D1QNLTTR" \&&($eL)+U)rZ~)7q$.ߤoC9ފ!H1!H 4Ey)"=Pa MWpF2Qgv7sT>M8<3GrxT#Z'튷BTiFJg!)p(\t65gBr)(_aˋo^|W"ϼZ-k{嚿Q.{wJy7!ryI9Sפ1&N8HR"&Bb(~fɻG%([I\K2RR J9ȡ_撥2P8@JyET)E߁Ծi +^md H>m,{AeLZT,תr CU$X<UeCvր*b$I;EYZ.Ccj?uN2340724܍$o#5blcB8^rF8ED_KT&8f[*C l|NXZX5ܧY/AU,-Lh^A'#wC|쀬C TImGOHiX%`5 ľ)q'Fg Py{k1 ŀ1c`E{l_r)}T]jXf!HQyI4 W ux&PGaŌKm b0ŶlezB9NNcTK峯}-nZ^\S9pׁRDc;fc9vdze⟕fHr,y9Kߘ~ϿAڸiDk@C +m105c/cZkcvb#7`6t46'ŧ{Q ˵ojCRc&' |\WxiX 1_(sAjMdvWnc/~rq6z>SQo]WIz#UY!bQຮµwaozuz)mr>{9q9_]A#_N^\#K.b]v ؙ`{pxDžvuQNًB|c[ lz!] v.I`nw,½ap]3d;l jy6yB**515__k _Ok̻pwߤRT_Gѯ3Y6Icn#pA>#ni;r} bqqoo3~CqzMzn*`Gzz'h7,~@O6ǎǰx :H{h̻ܝ4zZoKcVپ cPlj4߂K<zmRF FJ%z)R:By7NcF0a>΍t坰CD\Oz^}翔)|{]m no7IfB!-\FA#[;`."+#;0%2Wa֬'/Se|> t{׏a1 qH*;[ρTQF ؉>tIbVlY+l9YgɼY,}J`ۇZc8e# Dw$џlh }v*LiDc2__c]Ǜ%d1JewX/u9m7m&hUrFiZKc;&cÎQ2A >!Vٻg'W5ci|ɆmLƟIqB"ㇱ F"O'^QN)8UUKsyv7?F;?@amLu;)60@1̏S.2˄?.`ypp$pՁmG+B6WjG5Q5vUDe9#_Cjz)n3CjOS)9>7j,Xs/8+b,v0Q*!D]@gRgD/Ot mLLcH7SZ349;zjM!6E sY*R"Z:*ߩWNcq^lrޯL˔|ҝTwnyG"9JeaHO\o<Ǟl}UnΪpTKJ\TD廦+5W9n%vVG2UJmRo(ob7+"/WB}_F~0ߏw)iE(J) 'bKV2=%D)! Aq WLPܥ*4d^!rC) !$_* OQ EBR!0>ULh|:ul$n:@^ %q=)(E0rhn5iOڌTk)?J/:bJ2 01ǎIX 1%gɋO"c Bjm)URwA7 UhP">G1p{ck0ⲒƎ޶?l]Dݑ7R#'@ZW(VDķT yM E_p-S>~c=ydv\{v7N2$;_ln.r6^yagaZٜk=:B\B9A\.ÎStS4Iy)y^B%qSjj;6Q_kaea-dL¾: ӛtsF@nrcF:{j.4c^f;K;niWq.3 wQG}1Q&Ƀ8 A}p'Ω;޸!uv/:p_gd d ^ɑQ̀]E~x_:`Ds/x^K_Re^F5:+/Q^|d}VmɷVkg7ޯag;8} }]>?}gXvEHY" "YA@9s$0$ &HQD={3gu^z3T]]]UOrnzh{?c{QU$ ӈ(0 P8m0s/h?\2'5S 9t@ x1uѰE2pd m&&a_ńqst= 9 msV:FjS8=-8nW^ [o ٣! Rmh4s!:"ja(Gc%SE]< V;c;sZ وC`cN}ɜKwޢ)*600M 8ȟ!Z+]`OLi+#ݰ$L3Np?w*LB+d5Qt0^|qvEq0{2dk^{.qyƩ?ΝSj2 [,YJL(Y n  p=?aqwΆz:#ep~sGth.SB Q0h@.ZjFa:z̡2mg*̔]|L9,D?(С0zҘ@ v'h:ȗX“]U ]Vaj2w6:rB,ht@rwa"Ɗ x2z5 BDXg.-"#1BL0>' M1@,\1Ϧ_b #A4HCBA!t o13R>]6wa h!ۡ:=ǒ$ [ck74@"ڥ]A1PFVzj^YHzt0gêC/Vz{4t#MgK9!d>&X0d1%x!1! >? X~r!B^DkQu&*D<' ]85 {sZokCg0c(Caҿ$':*O4{&"É%Q%*bNDIl!Q&⛉~"#~Ȉid"-RB{בuzpj@b\3x]DUB(K)Q@2"\VڑHKIi/Wf#GĥQ ""BzKbr=cM_[#e3G0|m{dL/(#Aed &rDJΘHʏ!}m4"(.%ŠH/DH$TE \%+6u ]m =0^.>x ) i%Q"$M$&U'"*FH"jMzN&sb§$aqX&`"I}la[B'G!OLDd4I)ɐM>@}p15 <هh DSDWK/IW=d2xLA8Oc12Km1 gNH#r$f$2e#}@CQisAz'v$ ݓsc>x8+Ms+Zag&alC87ɽl~4QYJ qj?]5YZΤG=sVXash1W-/c|zc8kBAڬ6T:]W©РC> /}/xܜIs@Fc}9!l>sDҾHWe1gBFЭ>VFht_|t\ x{oG샱{А.Dv1eLQFZ.DmcK׹(TOZH%]B>߳?1/.SXN!fh`hsoO©5އ򵮮']{BzAhQ#sh \B"`04,Cc>t+C7Hwy?N9!= ]/{@hM/& zxaǀcc1gpC;L"吅h1"j-Cj1&B < z& N. L8b5H$ 1l0OzŅp=)Y8>]r]6"_b,Dd [d=ȴ0h"0`#<-oÐ7E_+xE<4 ^PYɌ y_ l <2똰q sqJ$:&+>,|=ދ]D5?n`J%!W"M+ȝMlGlxBzX8  .ǰu:s8;\;uu; (aT=c8dlKȦaBdȟ==9 މ <\}Z'v2廛\W?J˒[a-u7#܌j3|c#2~j,doU&exH[ L*ݠ鐢)` wZeC><)"rB"[9bx,Ba̸y`KJxx 1sK\Ӊk^ϝɝ݈ 2 ٺ@ifa֏L[v`va8]6 &Ó0&x@#$}9@Є|]7|#h4d;60z<๾^|tJ/X: hx@l#Satx؁$ ȶio {XA%Z`?D G2Xt2~:= RM4\a jla bR<@&F. g=0:1 D1h`F^d|.t u,1t8<5LiFCšG zrЄ]3\#O3j!ЅO.|Bd@/>g,H쏣u Mq. =}iR.Uт=7a1)`8i1QVaQc~:x5 q*ʩP}$`F i:>> !<%C1f IZru0UTs* %""]Ŝ#BG".E><5] EhI M!8u~4I |yQE{Ya)"#,O{:D!+bJ$D-NzYIA#DP ""9D@,CKpM@2 05 QJ"/Kdi Aҷ0'bDTB&% 1%5IM$ҎOz!!<2.!q ٗxJp ,ùh$R pJ枴= ,95t k࣌EVH򑾲DTN""O/Q›3*#RADI**XTߨ VA  X䫘# qEO U8M@|i\dyI_^"GQCKp UM䚚),v5hbE̬UJSE@g/HC@?nGb, ZoU"Gx411puTp]z1cERdD8考=!s8Yc>iph(5y@k .&8 0 Th!>41hft`U0@nheWGfqG{qPs"}WuE_ \HxLb ncØ*BL6HMęb3q{ *=Q(F As?Hn ?5 F$B  0-La(b -0Ex9Vs$Q$D*#;ȷ5 =|T Zه2R1qWpRK`ѱN u:tb:pO9t |~9 -w48B-K3yw׀T\n|)S57zO S9tΰ3!QcA|LȂu`hM‘l`ko >:xxOu9B/⃋--Bt\XHF-]h s?VB%^z~?B0a''rE^AXy 42C*tc!BSICz/J}(]V^ d/:F5!rێ\50xn-z݃CkNsmu'{Qhu.g~ރB4ac(7{cOr nЭ~V%ו֘Vrun${B=X 4guD?b0GcF0w@A 9Iҳp[$ɵn;{AFTa!_@R gSA1xl1cǍ0v)SMwt9ky,tu[xe˽}~[wu7lڼevݷG?gΝpnܼu'0(84,<2*nl\|BRrJZzFf6_xGO+V5~Ͽ:@`zjF-0[jL׈;?2oS{}6g06w\ff-Exxxy % 3P;}$$1d`Ec6QUW+gbӡ4gWwϥ^>+|׬ߴoǮ=>z/^zÅH4iW.i +HD;P؄lF_mo߾Cwt|m?~5DUJ3|K8L} )хK!;ޱBvB޳Bvd3"+xG.>(~q_~q_CЫ*/n/&kH!{p8tq`m2&E|!r&Ԝ=BEކt[pX9p9dp9Քc5aoCMt~Fv:cKp妜fƺ4^0BYS9RQ#Z:?7..:&/|Kvh_px9DTyȆ< V{kXq_C~,#ņ# Y{/|kvvVX79k@=c:X;<^W++l3|Y_pgy` 4ojR]<|bO RE/|=+~*&CL+?p484*3l[{&8dC&8d}=o ]2%+Oee,JOy9#ܿ-#,==4#5$#%dd HEm:oeܣr-*=' IwLO򼟔qRҦqkoƮ}~5fmӥ.MM?Y J%օuWd7۟JCB9>lk^%gӖ?:ɑC)>WJYx\&_R^Xcze$(NDTMxAbS.sfqg`y?ҧbB:Rߙ8~bNU;\9R6=pCȭ%3c7IX{~…IɾWҏC`D q&&s50Ҡ5oYA#r#/8/8$S0}sk4!$hM8?Cd!}<0p7ʡ|GtO9I{YmnK9b~?$sw)ƔC{0ruB)!o'rHaꈅiEAkӏrxO9$SVRl(M1KzQg \[} 9$Pcަ2fK |rż7RK  2BV>cZ<~#)cdR{K9$MF( y=ݹ^)Ѳmic6yָF, [Lk;Ygq4ߤ >~F[䍭NN/tdlyBޙ ; .Ɉ-uLk7R7&L\R7 ;tݻȿF|odZ2,Z3[&mhMv>.4mmYa;7==r&nK1kM):|,3l׿N?W7:&/cjIfp6=C/ޤ}1B9{fXlu'KXNyi)SզlmL26zksdWQ_EnjV`w%͈9ˤ A= V+K ~g=2 Oɛ 1A|5U\[Uw>ηl3m^ڧ!TaUFcoǖ̌HC: i^O.|U9[߰wrC?_>R^#|r>%"^IҊ{!Z8!wﳺ8|.χ8sc3Z\m]7 vXaߟwP=RBy2O,be-;`O3=ve.+3WghKR&-&_ei4.5tl2u@TSU]+|ȣsݟ`^_yΙsfnuڐX|3ZRl^LTJuZ:%|0|k-崃맞>Q= Ol}tFڒY1Į*%~E;xyܷE xX(z=4ȿy~_`{r[Or˧2ǠOf/y2'' EoE]*iPJhdini=bcYo˙Qo3#}w"CG3dahΒ5ߠȻ-_*N)(WZ u G _ؾ-t|Ox乖 Ȑ iw(br2f9rB_ Պ2WUT,JۻtDw赙^O[G?r˰E2Yϕv^) Z(I͜hmV/5*.˵'S9os&}%.- C.\nQ +ŒQ3 IÝMr՚UeEVT⛄\7nѹ~ቨia@}t+>6 VlVy6u &uu 64)WhwX ͦMg#IN3g2gwvrng; [T:Bs ݼ=ClbEMJuhSL _MBmp׉" I]b9wl f>fj)?aO˺g)q3KE^%ڸ;B?LwؿD̷d̷jԿa$cػĻ,`Aql+Α?6 ?-pMtr?kb I-oSiiHn|Y=^a2tzUU l3ήq<]nclepb)HR:ՊZUUUZ?mur1t%u8:a/f} ;l#ӾѻMstoY ^fđdc{drmr-5v5jݨhըh٨G5X5Ms`k2Pxm`u 9lg}R&E#"FE)h[wJwH˕+4ʌʌ:LKMywe/U<=5}t̍Ǖ+,YĤ>Ip18fd~L}8V4EO.GOFWMV7rhg+Wno erA;vkvYvA:/4ycTFGEF%GG =\UΉ]>WQ&0st06 mV,2;?sWeQaǿ  BɡCM}4XOAf鷣[f;9  Щl<1^PyHGEVgN7y~7yawy1 J_ٰ[<ny4 : W.Gpwᾜ&M.^=}!ϝz{{jPe"Ğ]QG07HBaHT45T݄d̩xH˪ />'Ͼ^ǐnM^k㟗Py}^?$dHǐ$I&YyNh6U/c:٨`V92F~Q#C)Ȳ 0R?!]Zy'Sh+oDQx4=E+V gʽ&4)I~ #C3 Ȑ!&E.O)t!_5~HT'gڨpܬ1˦7#u2>(e\`t\@d, G z<㱛 Ґ!$۠Xϗs[-R\*U\VOmKl6+)N y:6"?r4?jWA! !2>4Al~*!_bXi\MR͐AĮݼfڜjn|qId_&}C&"^DFw i@f}BA\+ƙ,WH9TqV!$5RK[kL;=KFKF݊Fɑcq!^Q b!Adґ!So*,PDm\LNtS|xXңtdàK ٰ6Ơӣ`УaЫ"ߩ4f%+z%)z5 )@2E{#_R*V0ՁŖ+dujukCk]+u\*ܪM&]Ew rpճ?gf-uN J fytȗڵ-͛-,k5-Ėj]䗍|kUn<9nItÌR,(v\,&h'm-O)1iǗVo.3p.5/6 UoSh0Ⱥo+RsSuMܹ_tE4cQ)vF/pB0}T(nP8hQ/#ӭݭ1u즙4 kzӏsN[=OlF1˼y<^LD$i U*骃ZdA4!KunİiV<:| WΕ~xO|[6< 4G0a;\w9ȍ+ȽЈ2M [-{hXߔ'ӦWK&2"ʛgn URB!/ ~, 855WBY f8koh7iZM?v*,m0Ԧ͹6!-55-5-5-%޴ oGh6fHL ,iEh#G]+~hqrGe^e} ճߙFnp#7-F7@dec4^InQT֩zk *v%nAyzIdhRusGWhoWBogbOgRWGrgGJ{{Znd;"! ]{"ȕT\+\.TSW l-J,R3R-"m]]➻yy'x{%ux&wza ߀$%̹Iy_}W"P%9Ӭ3֥hݡ_S[K1I!Y8?Ou LqKvItJiMvw82D!C4 Hۦ$e_5ǤHM~qi١eeTl.ܸNRLrMXrmPr_JnPd81ȐIId^+Zi ?yBRƪO>&K9ӻPBiԯmիi6-MoJk!&ZFZBҾ 1' |Ke, 㽢l/DZg$e fR^Bӝ;k , kZR +j2M f q_!>CVyЎw=iW5(X٧=.3 nۍ/ L* ]ˌ:Kt%9Uٔj1F'!z>וJkl{ǘZf9T f.9ſ8J{s;t:uu; #uS5: K˿D ^Hy_)aU}#/01U-g '. p!MK1eiQ5zT^>ol,վbJOiڌڋA<2$a='/:f2#[TfҚE" $`ΐhǿ;PPPF m;gPXpJpW[كA)ȸ}|Ѯk &lN }e5K@ ¸`ҨX¨l~T2WSwUQjЬ?tqOoGnQA 9U2<ןٯZ/9fTW  ąIOʆIMCCC]ݿt22gWsV{xxO<੢6Fc&+%{k:˙ڮzS ]wXz+T9V9Q1>ѥ>8` V ` R N񎹲qu[EEoB8*!vQ13vQ0f^2fZ&zL>z@)K)Š)k N` O\%ULe H0t_7 XҰXTq]P_P OXPJHXPNXP)Q?S7ebT_g 8#328ܹ OKTܥIj^S%]}eyyyUJ,NUҀAmbQ]bqmRImr .N#2?oD_T|tOtRu^[66XжIWsOyZ5)ZnڔVYAuJqMJiujYuZYUZdp? X!wD!XJ ͷT;j,[-XǿpMU ɘUKΘU/L+O2"7UWWdZTd+2Ċn n OB0 @,DJCf횗[Dbܴ#y\?kT+>{X7/˨<5~.5>.5>ΔjJ'jSnS~dD'\E>P $gJD_T(=/5hWq I6K6 $:{{D4yf;e9f8R\\nιe_ |!ycd9"t+8Y& Zi2E|u?rnldqgEe]I`Pqpf_fWV-#=ΕZnO?O@? NyBJfjĞhx#(*SZ+o]_b\dkU_^mM2 TS}r*Ԋ2R/l]Y)9_%p{U0SGL+M:A+R5ҽH#Hβ(-WKu2K r Csˍr˾uW 3>r^6\sR~BHhDD=9)ۂSNѯPTy(פ*Jr5EBȂ1;!;̧scuT$9YQij YsTiLZbBQ|GL|oer]EZqY:4G3 AX~xSxb7O6fW=wAH2u^T#|V㕰pX\n*~!Ya$4Qq4#A~&^X]RXR `/@ğ v}WhsWy+Q}yv |3 TZYk܋hQ21r qrM _ h0\ϽMد^|J&+}@&&[NG9n/ŗA2baRpIp)"nhKLzY()Xr =;bylpy[ 7ҁ)XYyY3SeVv9/!_)e?=?YK_Y@/b<؇p c؛XOi8VrXVlܝkSp/ܣw{Dx j@Gz+h$oUȻ*CYU&ri[ps1|i^cXW.`}4Xܛ珇gU{?Ӆ[|pG\0V,pKn Qxǒ ,2,! < ( -ej,İF za10h:CVp8C37qp \|83V 8!=q?:`Gy}jF°at9nc{;1%U? ?_n>wO*cI:p1pJ`1+ +pk4T5w:>uY-KZ.H[ #_ 1?}JȠ'xd#%𻠳}I'! rPe$l m [wY/IZ[ YNG'p"(?yϞ: 3a"iGvGn[ ~[ ~[0 En n,e;/kJfRq48b A4_u :),.qGv[aKiK(%utmq\lw|#0ﵟTQ2~0>qt4A23 I*6qGnKySuC8uC$mC$uC4uSuMeQe<42ԧ:ҩL?md0xt̘L$x}P noHbn뢁뢱bduBu\DzL}RmDϭ0ޡѬ倸"!2^oS s58).hYl+oX9{y/^<=gU{=5LniR` '@#;;8(,@lGCn]*7`N,](?7ۣת_PX ,`tOw;3pWްR"*0дYQ7v`F#lXȬ|rB^+frb@DSd0r]#*.7X" \^iXM*;+*LJR†5aZmaMzmaU%-F-Tl㖈/w ,/{.rC0?v{)%/kGUi+=1#s-wTzdtFztVYtnstastqS դ1&˴1&ݴ)& H~A-夃10i f_Bu+q+v-rp")d[d>-x^ LܗRo7^{[(*LQ +%h:EGy[;9;:X;'X9lKve{,/ ү߂ϥy$3|३CU:ʄj ( d]BoHa[YugWlwaGQkqs TFr,R v` N@vL<1^#pASwyNZ l퓬acbJjhF竇jPu}K^9ec/` ~A'6~\(i㧡v3wk8 jd+ubsU=\4,RuMT)*IyL,,m,/N{ip(} R_2~;[||hӍ̷Jٲ[$p2 6E**4#O Oϣ(RjTRkRTUd/{yDu2~[d}xs!N>>.56CI?J9JR/^>^&4V#S%_ZP\pa:ƾ[4'L>RT+YS/F -Dmq^ranP\opxvxgdsGte[lAk<%Kp;B~,agh;^lۉYBfyD_(YONY+NJLHzN|E>"/}Df<^tyyz|%x}zk`a {C ӅˬlKbKlJFotU9,yDD\]/:/:Mu[|m'< ; Ȟp/Դzs+zP棟7\ ݤn j)l$A|O[]VygH^Z ZM"rZpu0Ra z1܇mܓS!p'<|dLᑐ&JNEbAKh>:ac2&jFFlv6| m?{Uփ0/_a{~,~ǂ)w~n7[LpwE$ࡴ)~65vUgQg LO`+5zpU} !d/5a-T D;ÒG0,ٟŸFMuD+W: "@cFIf`biz~Rt$E ZRDIO/ՖaU߂a)>ap`;L'opo8{K|?儫+Ch=cx8y= Khڣp>|'7ٓ< bO. %PbUގa5a6=FȠAy=/ f/ރ.ކs߄ƕ+p%xx/x ?9|1P;r~pg^#7AyـO\8fSe`SFO5`F1 CR5`jDQ5WT]x$4RrFs\jVkDjNs&2 42#l, #8I)RR 6'}`EEkQPޮ\zCzDFu&t_IM뼐~;$3/@AP= #_\U xyAV\J <&aon (1pVW6sU!ܨ+ qiAW3Fڇo@S7h*8A  d \fbo͓iWlhAtQ|ɘܤI?~ڴKYKF:Ƞ 3'A3}"c'`:B&yeѦ|]=՚`ՊP;|exqFzb ¼Oaخ4i٤^f6ֶ)v)v5)Dۺ$+kRCCn\`w!OGrFoOyvbku9L%"y8UH-[}og_p1ىLq!iV9$:%'5ę6~.0Cowe?>:^pǖR+y9LYT%#Z& ,A.U' U/%Eſ*]^RL9?_C^?\ug_g݃Y..*K̕U,]t4#bm#ѕJa* qXu4{!p:OJ8G37X=giZ~WxZ(R;T\:PFӕ7Rq#)˥dS}#eӒearmapH={Apa/g-UX_#]TwmlbxكqU852icby;B\vTedwDADaD~tFLrg\lG|TG+d:z|۳sڏ߶+q$kLB?NfN>aVaE&1=zI+Z9g Z :O7ц8Wg'AW\ހDsOIrFBl(y֕kދUw_ݓ3uhé +~cOGx2:4zMp="B}f6$+BK I+6"ecE ( F۳j܋(m'1tezW%4Д1ߴ)+}{c`Cz<3z/ ^2\Y D? \`7`DCʃ߶~pGuQ\z/N]|'öújͲ>RUi:9JsjVs; Ǡ5êKmڃe>u]oi}۴"O$xw8SAFԕ"-+ gϨI_7Cn13}'@A ̜.r)y 82x QՈ^eFiİ.t>z \^a^#8tHW?J/ ™p* \.{އh> t7*]1K Ow Fρ- 0v GaqۣS,Fc?gdzp=8{ 2ܽ7^ ?ЈĮWAUbX zBz1u?a:o=ʀB!q3`'`/o7WKss깳px)x|'<{?:*߇OBcf`SEno[E;}k=bڳ>u QO BD]UlBB] Vi`Qfu`Ij&\<%` kos>zO %ECE T  6Ɂ`O0k!$ffO(k'!`.fC#q ak{;y@5xݍPD }?>?%)PP]% [H>@ 0Lϧku,ǂ VłEݱ<~z]{?~G}<,cO[cD|_@(JA>iA)мLPJ(0'˫qZbil${B|btG8=[pzOu;SfGgV' ޒ?MWfw"']̦M=3v>0mik BP!ES &ʐk9Â>Өو!y)/CҟL!qԇgRޢK3q.H[[qsC d A^4ġXJl5{'f  3ADiֽ-&yyy-J Էsƽ*G«-Wh1TyaSr#QQj] E.0=>NBzujAmb RWm.<{JѸ{mO|^9YɆg%KTQL9A(VC hVkrzc.QEBzĕ̔sI99'Ku-?]7aw]˷$?Xb*qd㊉'+Ӟ/0p 4\C C?4.Y|pV}-nS*Z٢cv$lKْ7̈́ǣi3EίT;:lgEaj>Fhgj^OsVusm^[uEiiYpQYHAٚ}ye J/\+*SR|FR@*0xP$١GӨ 5Zlw7]l)tjʁ@+Gsڻ+k[[ U3;GjV\R{a$Pffk=-(^-⬋,Wʲ<^nPf9\VݛL6 u\C ed5d6e%5-onkn]o4Ȩ<\s?j鸆t^.dvQaQf]#N5ݿI~õ[c"Z'ҫǓ FS轥ޖ}{W{hW{W{ 9zЛ<Nt4:|ؐ{A{ <&vn L@M)Y9T25z2I^<-rح֨ڣ{otX5&$džA{Npl:i-a_=䄜MqeR"66646o۴6ljHE@HZ`C돎e(BWY9Ǎ\Rch&2zQYIcb0Zʁt꾘ҞIJнy!ˈJ 78[Eq۳Ґ O<[r) jYY` sؿ'Yh<}ȷ^w1Pp?B9lt&2p&>'LNNYg_bҊЭ:7v-[h%ց'|Odj9h?tʸwׇq' p',>N,n^U߃8߇S>м?z}#dKUE-ؿc=Кlh+>NiY;=wrot2Zƽvpx3u Md(wF-$\>uy5Ҽ=z߿8BSZ+$UzNChN_>sX;~܌ʁ0g;;;8EO&( Yh "_,g|mXBv=>!y| əB.:jd7 ۻۂ<- ?@4¨lsч0&:gB F/[~ \ !@Yq()7h빂=[98Y_0 J,UB%9l8 <C9B?[ppE/(; 1j.j:O # E:Р-%ٷ GZynpO)N rI[Dd\CL LLKfOt[)zvGY1A#_u`~ڃ ؁y[jvK>g\\_,cYتq ؃~!Ϊugr g0X ;03rN`u'kKuY¾kc 6xm s&:q Ua+ Lc>W0; 7\ X̺3X{pN\UZ p vZਧjl~`Crx|];{Y'`F=b'Xnݞ`}/{Cwq_n_q{Wp=s) @Hp jxq i ^c Ρ@MbN_Lz}/{?z}w> ! $Cц073 ❉#ͽսţsk{#ag7A_8`x+x! gC- [R|d!DN(j@3:K"n>4K -_Z{w57~m/V\$hďCK!|+)d|{S$=IHPZLvm1<8$(K2F|;tVͰkɗÿDN=JFO;j.vg}) kn.VFRT SGre4>fzM rxN'<ć%eFVLVK{4{*BsbF=EyH?Nw K®όmόʹωbx!PB"!Q!_KW{ws,GÈ BK:wR8IiJ:7:??!۽y!OJ5WVʼrS{Xot0r5Lr"X\& (u&}-cW@Ǝ؉M[2]*s:]$]wY+0I2"xy!DL¼% \PPMFg;~ZW*CmE͎ܗؑ%,{SBCuܵܩݹJz"uy)s1)or"yy \T;'JrB<ǯ:5-z;]^Z "=vVB7$g3s F2J2{2Vdl(8TޑOy[̧e-J34e~fi ?԰GfAWSXmhۭ')l7@tn^X::p%=)},17n82_9T[1[M^SI_>r,qqedۣȖ8NNga؀m쾗W tz-vmޯ:Ϝl|.oAv5[B}7F%L3V'&sK&CWY]f_>qn.qe~aϋzXABڰakN6bESXV78j'~]e ݡ1ۢ·&d0Y[2Jھ7-p-i3KS-B{p|B#e?hqBriܓ}GBGRe&.?wt"n1^Gм|SR@!A BWpNAvkcC=7P-E[7dn8j\s]v%]w)&rZ0k+B=$zܸEpzq!BRV#t3+8v+l{VL/TK5c;GvA<|x>su٠ ./O;|f}q ~Kq`9BG@hA&N!ԏ& zNjJ.˞UOՕ7R!7 |ocuC(ζ l>79Zuj܌xvKqux'ނⷃfɜH!CU,|炉󂵱O'3_^fQ&lalfD#=_x6# c +n!oqI1E)wPҫb `iچࡣ::  u*0Y ԕڀw`;8r8&B9J|u3xAH@F1tuXI,QI 12&'%ЌaHF V/(KUο)B7%'b`.cQ -RyiPQ-0 ,-!#PNEbq]xoɯ X  ~}@U]TdA@L %@Z\@M tD (waT[Oiʀh*xJ4A%CuA^;@e3z OOUC]| Zs :_s N\q Z2+zF c nImHVkC7͵a.ooA>/>"w#`k0Q]M0Ғ#}0P}5 =&NhWv11l4`ps oK#0lƿ  }2Kb`*/Fj`.:`aj`&$|x|)a9ua0uf` s NME M-LYW 0`om0I(K,8)zu1Xm ̋j,-WXij۫X|h|,g#ov4s5xݾ'}/n yw8xB; Ám ݟ "ђ|?S E?X˾ej<ܧn=_&] >L8K8:J8pQ6D=#z#j7!@X(<$ LY|OE3z1= _!yq١HuRu e7z(2WDrܞ!#!b*%>Q2hLat% &N'IM֝"3i6=Cj[҇ďKI< WDY>J.e6m) (R١g iFZЍNs]ZM#%t&72kEY5YťYˋf,ϺyQX*0unaƛŒA||LY=;Ǝ`CG98mQ$lpj ꪉjHJ.`䖗6UdTd)S{<=YIF΋L<&_# >,UNB׻Хvtj4:8jlr Cʓ}˻IN}mȺ:FBYejVn)("::h*hG%bE\Ӳg%ϋs_,q}DlPȂc)R/+:3Š=z[m֎y( wR|;iᕭ„ʼ ZEeuLEGUtʨseʧeJ%ϋc^(4vaD}h-kWMɎ n!Щ̎Ĕ\jSN <,i$yK1laXӋBR݋䊗V y%o5g47ڰ^ezsuR}S>mVQsGhFl_J&';/ -?w,7wKvHY&3Mvh˛L@b_G~vNNck-B65[ЊF[:6y4l7&:L|'W(+ƲC2c$J 7FzNHF3x: Na܄j%^]=V+wxn BtKH Z..6x:#>h]I|fz؀OGojh~st_FzXoNb>Z1젽yQ1UƣƼUG$e6a pK M E ߕừ任1gPϞ !{O v߹e1sHXoa> ?pi6T{AU\(`&uN>NiOS'>'|N&z8]qz:'μtu>8}r7Bip h+<(J8`q4[n, X (GЄiuZ~6_;6P "2Xl~!6S@qiQħ_$KP@L8@j\kq9|"x$`tDAYMt$AIO e@F$}И]0M% 0;!3U)073E0TU0a&b5h4\0aJstwmh̙bq[+_Z,j1 tYޟ AON̥,`o6.*`hI^Hn7gQŲAU'Aݏ6+tgmtnљ۫[گ^h=s~Q>v`roL\L,) %格9ɞn8ki4Pl֡c+^ L>shuܯwME.`q,/w5Xc|$ XA"l$#F᳷ƌ[sdny+z425lzkzv>jv|>[^`wpoR\pv>/DEM'Y_3R-YyC>V|o\󭵽j{ɯy5vg6۝ ow*G?8 Xtm{m Ʒt7Rh2\3.TYH_͛aa TA)Ngr]Nw=z0v0vq> =!w൅Bg:|lp صBx*~(p|Lzb NFE*T$hxۡ a>{ê|w5 >-|ͤC~IWE_K3F?nnNH`41YloUgrʶp*)0=vo c%o+9;h$xF(5I^⪨ĕQOCƢ.Сh%'< Nn\|%)OE" +E|ddI ƈv@OXKMYM_SAZImXA.XN=}I@`tn\>4S$b/Wa9_nsEj_ 5􀕌lp\q`\ML\[L_@LOܪ-θ#ָYjK|LS|tc܏ʟ'/cb@3A)]ݿ *'ejSY44Fxrztwb^l'<of7270120ՌoU hU ߩ>w9|aE~%VÁ5`o4[([y]EѪHAo_v|XgFJtK*318.&&=:y82y*#%c655cJZǤ?"'#w^Ղ;GѧͺךouhVkEGcKcmL@Ue\dQiR0=-5//;1"/>5/.w$/6o}.5HNLރlZ,z8lZ|և?0Ke=@b#B:ԃm`Y;dɳrUrW`Nri- ϩIMHI+efǔE4QJsɥ9w"g2Ʌ3Qӣf#;;gw{3Z7Vq-_$76lXfWEo3bdfD3kYak3BI%̦V̦Φ| Al_B v׍UhtѲ {qƱݪˢWf_t@RwlAhH m+J ikH!'ۧ w>'5~f}fj>' !gxkCH?.תe뜶or^Q*${<8?,BWXPmND~ P3࡮C3 rݔlX?Pzb$Gių>EgϏ˙=!k䇂#P*r pZ?#T=<\F=< ;"̈rϨ;~o,a>k-m2"cO#IFS)ϵ:_$nzVLkƗQO؀8 ;xjN"=<ʿ xX~p,p-HZT4!K_TƢ*x)QT"),UB+(p_Iؽp+q~QN!Tp_E>Eb-yAO d@IP4@H,$IP|$ \P-<09_~7ߏN#Tx8B!~k"V@z8K8xWD$A_@9y Fƅ̉/po%8?ο B^/rx,bX5q ʸy@Ҁq +pr?2ù28W18;g1 Y %qq6nK rNpRE#] GpWpfn.=~z_@'x|O ($4@F]d4A\O%@Eā?ZSD/_*AI@hHDž@d lѝ vH A|%%JqAFDAFM UAAUd%@D$%ACu%刀xH4dHcFE@zRdc a;- 7)ZP ]<}/r E>(uR1PU߻)#)PEo)P8 P5b8(bz/*V^bEi<1+Qc^:ͨFHS(ȉ(hctAOOtA]4 iL/U)5(]S΀ԜΘW5R_6J~%IG+ J5e0/BdS} j8WKR nRA,LL_!Y!CQ'RurMfL{ޙ.}kJz;d^ZyayAG32-Zm PToڍ?u)Q0"`'&.FdYy)| UUzcʺPu3&']Jٍ+>_pa= w+r|pqFüE{ӆG}9bt~{|Lwv }r}ϗ E|heԹ^DARH>et??z,XrG>mA筶=f} MfU߀qpaeXaֹ8Il7hVeOFj0OCHIȵN,JsLls!di鐝S!'ׄuZ:<eE(bw{rB8;;иXh6I=MBSX/%Lp:믱'*t[d&i}xtx}5}>AX"bhCo="IK9cעgGSi^:/r&˔pdխD4모qJw9o775߿rٿʿ2FV 5SOkQ˧$l&́ɣcFrDey)mH 6XD>>j~p/Mm$tR6Zb u7)1>.1\ 6#;&v<t*AK m  NrKO nm7kH6R=}TK$зGTŞ}Q5,0b7 'D {?)_.VmXW.0@ky^y?ܙNmIfI y䪄ʄ҄хGa>SFȏ[ Ϗ2pU \bhG6+5UnR+K-1qԔdfLQR1 66/LZOL:HOOEOO@MOH\d2~F e{Y9݃R|ػc]/4jL7ZLԻHVK =HNd$M1&ĥ^KO{HIL'@wB|΅s[3/ZߦVq84z+u7WYהJKyZɈ*IjHe&dM&E1w%R9zLƷXjw*-{ !9 Ÿv]}6s.%4e1 )]b^QTPUNK*If$D$G$Gt' V&lg^-x7GNP_~޷kCh+=,he,7`oqnSj'g7R2kaD`ת0A׶A׏A} - am$<9yur>6\X5@M.h_ǀa5h1W;*Ӟ>d&!fUGX2/ht>e)?`e]@@Ͽ_ioG>?zro X8{[Q=pzN􁍛@>l̆UU*kJ&AaH;odwvJW-^'F9zⶖqrkpYN߄` ЇA/\U w1=sHnW]^j!fV^6|kωJ+6K> MfnM<4qirJl8[Q=b o O;& I(qǍmDxr?9z,[xN'j:p)_nI]{-c33LũLN؂C[q 0y3dC/^ %)*t:,&mI<4z!a$Ui:1g]zq L)[E[M[,E59Uy$!AXc[LOҟ I}ː۱FQ%~~؃'P _DM׻6,՘0DTH0Չ2Kh![Xʼn ny,! HH?V, ؄_X#_ϠC}=s Gj`(,fJiQd20X!@X$QY[8=y N?@-P PФ01M@H!EdUD7v25+YAE6&4S-A T@(\a(W"$e{~:m^r G#!/' `LHc DZG+㰑"TOIG-B 8Z0&,a !B] 1cA. _? "w _4E5USa=DHV8af"Y%LXMlng.eUL"I7#L"YR7I>z+FO/Ba#/%ȡ4QQ"*RDI6!2DODJTq"U F+DL6r؟䗱?*dPbW~~[Ӭ?U^>{}6ݥθ ~4C7"| VXW*h ʢHq(9uڭC`o!g/4_a+h!ok\\Rp")4owߐ㭼6+P =Ҫ/5yiR{Wb }}%,&o͍կ!9>o]<#ǁ19O'k|/½>XvQ78ᥰ*ۗndZӢ,߶BrASr!SPX!pN+ f'}J"› ^B^?~XdL)޿ž=8SnEIҢPEyю=e5fҊk*C*:f+K+I=V88cTXB*)&zNP,;J1XKY[mtS, 6n/k.wM4kZAyEK 22vDdx><;椓`$h*$&>PF`uZdwJGeAkyMCi,zFoy~FPqnNdAvqlnvU|愬ӧŧN?2^lwѩID4N8:wPO-z60`pkA_"Gq^@:̲fvY ˓;W&oJ?;.&mLl! 9$b*؏pSD= )AY^hHg.nVd89ܦ1U\[YYV9'.r^lhUotHhTpAU7g"A3y= 8g0`z^K:uZ#1gRBnтPQmq)MY!!3ƒÃzCFM|ׁ~$ȯW9Yp}'уYЅ> -}jgN$RÕ_#gIQzWMXȅI^!T;:z};F};zum=zwܛX#8'ϡC}rPƀ2s-hG2gG)}%_'aEid_mHo 'ݿïʝqq9sӁOgnE:T~^<}x`߄C }|U{ Cѧ8 įU\' ^f0k;f=o54kٚ;sh~3nk4w Vi%Q{c Pd5Zs ;0m oӡ$m`ns .8 %m,ksu[2Wy욦Wb`3J #b P{6` 6F~C{B"`Cﶣ/!;BZw424~dv M~4{h w ]aLe7më&π> 8 qiEU&]]5C.?](i47"oکo)̿Roߐĵ`3'P _D+7P6o~P*OiD&FpShc;xF_ROV"8r;FQ%~^΀21Xwj{-Sq*O|8⦜MIU@4cv@|Q7Ep$l<;V~'־ ǽl { >my?BmR/D?nBB(|C4SvEnnP&@iB՗ t BӖ %&RL e(YC#ЌtP t!وP#kg;?ai!qXc"0,!Gф1G:1eJDFm^o9}ǧݙ2-ˀaPlFoRђXq) cc ǔԸD6,rm^=̩FșuSkUqA+T'PߋisȑMyuy6U9n}Y<`QVZ]5{Wz5zĵszqCYq۹q'fž,%™ 0(Bߋ-"0{*$?,_π&*Ⱥr:}Y"\298%)Yr2 2C23B3CR3B3FB3g\ Nx!H /)B&$n~8CX*9 ƈh={^tl? eV1^Yi99%a scEg })$b_QY$ z[{+@[su\DF}J{-MWZ[Vj^X0}fGjI_Œ¢氰%EkCB&..*'!*Ϣ 58סC>,C7A{Z2]Īzɗ7hDؤWǺ&T&yGUd Bg *V *x3>b›X}mbd|&4/PvGv|Om<@0Ħht|_PP7_7WwރWç׻pgMzw`eg@{ 7钇nJyЌNxbo̅I!F1Va8my~mH#6۶ѧWSGOMŽN\Nch^DhCVw,h]P݃޷W J4Ϝ(!SY$XkוjەkUnhiյƒ۵ܳ뼙GS3΢Oye\݊W Pi9F2)֌5.Q2!TAZQ^IFFeFnWrrYD۩C/1_Frf"N&Zkנ[=i(b7BF#jF .~\iQEPב85L5N5* FF*؏(o7Xf%DrMe8[QuG? P =y8UNQWq#*wZmYiK~/i;)e3"e='i51[jUrObb "&ߋm#cDz*c,܋hEkQd+4ԎEO=a6Qˣ4 cBLB3 N3O3tOtuNkPLO9zEzIzQz^w.|Ni^)UôcG4gۈ'iHDwLh ]7EgM;K93SM=CS }e#(S9%̣XZX;XYlV wlfOaۜabm>Kl&Dj?= gqfsQk@fK=om't֋}>Dxb{v9O8Wtn&eVe[\VIlvSr5u.d]>ʭv!D?>X 72}CF|c rTUWf jZVu-S[oRݼsxo:|{p h ///-4r,Ca<̐%^d$Sf(JR\+.T.4v u  Vu N_4b@{.=;?<~"Zb#6h7~ʽa!ZKCcBS L7ZRhRnRc2?ٴ-dikHisZmfo2 "fs)b2X_1wN7&h6e(يٟ*0*Ұ=2t^DEkDesxUSluKkWTo ?d3+mE 0b=3X %7&{10,j; Vz46ԀLsFoXwBG_s^Bas\ycLu}t]mtUQ5Q-:ˣˢ6:Dwy٩(w/El1xs"z?c| blUXcJ[((Sn^`(9 q9.3]K*9űNAl[^[Nn1ݲbf|rΊ!NT>z܋@58q]_(@QسܥyYzs2gڕ$;HVXXX˝8;-q7#a-7-ap#9[r1)}x$I&Ʉ3߱~q8[Ps L!]3B*M3]jKghGZe9OOHΚY9?:?*s_D*^xV̓>!C3qCӉGX:qGܾ{*IR~#oRڪ4an9Ir ?բz9a3 bӽ#rxa3Brsr}sx rs<9<ă?Op< Ck!Z!hSzjU=]r_*VHؙᥩ%9^%ނ:/~I7df7c^]Wq|ǧ); _ ;4y<B؄{f9lѧlf̘*%௖\[n1'.:ř_*Uպ8V8Vmv:j]y׎;gq('3υoG+u"šd&.0;3{H&UmhF5GM5e4z7xm’;wgQSϦ&n o9uҥXeGw=j ף/[ Pɀn%6w0\Db:i/H4vL3(6c1c[&]Nm΂;Z:#p*Ϧ1؉yoDU w"= }2>␰BbWR#W1CsD}Ҽ^"7Lս'^ӓS[;OչOũwcaE vK(tU.n/υ1ߊˑQ{jDVj֞]&6#<(8%k?"k7'c;4 iZ&i=4"a5tPrW1կ%J"c~ Ϥ j.EMA?^0k-@0@tp" cCoMJK<J8HU?KQ;PIQ=8|@a BMh;qMsG?{ ЗKr p]otn oE'ml;w0;xh_݌s朸 1g.ԿoM<#m'pG \_T z?&&2y3|NzbO9ԿW+q|{'g!}E`lx3>{?JżQsv7p1_y,(2&5!K?!u!aL|=PC^[ zmKnc =hGX+Pz 2 w1x7??@]AQ81M&scG1"eW:цtFZلßp^7?9F0E a  Ơ1c 1$t,F٨QWmah/!Y^DFqS8rm l ?!t9QBB}q iAcl<1 3PfF5^*qE+OVOKJ MELT"4m\?Dn N F:bXס5ϰ;a7\~p~ĬNObǝG}qa1 H?d:P1)!p7P!\c΄+jjmp.9pVd~ Ew)pB8"; r@P^!t6C}eu>(^PJ[RnKu)>\rpN!(ipR41v8 5pPc}G){4R&Pwhm"1-آI7PITP_(0ॎ8WWdTଦ/v^"4A~Ù}Fմ= ƭ ㅴq&[MLo6Ј[:S2%A"f Dkfrr_o\ׂVf=B֩B;lf0V0ammbm`c of?+HkvDϖ"=6B&@yi^wA刷8K&Q].<-Na"EG]2Ć]ֹu->Z+ƵY|5ggJ΀ ΨDgBsRrT+NW"؅,r&2 ~ƥoﻈ.GݨM= i[*e^mrK:廽wz_]a! ?<(zA1YWx Ex{9 p8}z.l Х X39~~2BzxJKyݼl.^b^"\~ T-SkQkmQkTo]Qo}^I·~E;?yg?2kK( iš0 b=޲݁ʋjvA<~VX?[_$hiwujtkt.V<ѝQw?ѩ'S!8XXg-H$ c`e)}YHgLGʼP͖!z g1lThvraAK=4.|o4#D܏'~;}P<7Ɉ֕hwn)ύ Ҫԯ7O3 16ü"l̰Ұva;-BOYfyv(1!&7^b/8? n{d)Lt4f[*G)G.Y?+&tftEi4|5y9v#eFnK8nq6-uZD,‰7~-/gqP<k0` _{4,Ke%4wX}|uzEr~ibiQ|U^\]NlCVlcflSz\N1N1c8Er~mMlhb'8|D߹Vg8/-qhӂl Zy忰k\$_8ı߇yoVY4TZq(ӄ:3jN+Mڒ, C ;̨Ba Dڽ(z U֖itm2o˼nU綵*Nm{ۮ(ڷl7mQi$81y6<j`/"[V$z —*BR=ZjI X]!͓tɺtG;v;t;tw7uwv It풴$a2Dlơ \0M7t!-8]ڙKb{ѢE{@>`Euprd Z'YgZ  ,bfd_`-2,CDoz}HЍw@^@JC#"`= z`>jA1uz GtHh*]w43ZEG]AJQ9CQ~BUYνX`2P7z'@rP }>9 | r9t%.~'^7)_?wgL.*; x &kP~0q?OKC7^&4n ~3x5y'y3p0Ϥ\?7|=i03Ay 1_CWMg WԜz3ygBhd^iM1,36gL1waͫv{9s9p382'5O{y`Ds&eYc7$ 3iCg 跕Бj3@킞? =(E*z~,EVGX`C oa["u19Ac1cG>3PC 4oCLzz aI6civcN`#ϐ?A@^빃8 N\c00.q:Q/ u1fԚc-b-`- lpc\;:RX1a1 0G>EN dfNhDV@.v/܄Upl \}U y/ @h 턹CżP'uQu*Q\ԙp i𫓘q1#y94¤}taIP M0gk@MEc>K61A9TNw8q2( e/`KNd1`aԗB/ 2,QxPCm<8 S8! GEX)up@I^.-v ¸f)[ofWQPFadW` TK+5JH3Wa$ gl฼'R *1W-vgÄF,հMj"جtV  ʰ :ݛA?t?t Y/DhD (/uG.l8 `+e(:f@lAhG`ZB1E63K[kN2羚XI_m>`}5F3e柘K یL~Ek˾jۣAmB 0anHj@d Zo-4db/`ؗ+Y+YZY}=e%[];. /"|;"6i% @y;}/Bw_vRI2lrvcvw Y'&[)[)4/ⴋ/,XY%(1Ws^T;"U?L> >돷x>/qq. \ XeX$[ FJ-&J/ftpseڹŲd۸u^r^嚸+ Zs<S|PA'No)]'Ce7mw= T`ߘ4!/3*ƋQh%+6󲔚xʍ2z^rIסRQ]:wj ՙ>UK}^o\/7}'}wY3fԏfbM&&߸p<9Ц"d>RTⶼT ԡ̄]f,ሥ{W, ͏0řYr,}r+,sͽr;͸kLƞȢ\B7~[Ny;_ҕ`ߙfݑc^j^oe>nܾs[Pھkҷmd$rq0R;u| X&z7 A jR9ssF}#qCzQ)af!Auҁ1ӀeF~W }ӗ}isȫ1bLT카K`8wQ8Qt׌eR ̺f|13*Q!SҩL=B}}ߩ=ԨԢ!-+Ϫ{L|>vSuvft{& %,S@?[]9gsYbM)jٞ ^,|bKi^KjKKmiAe"ŧw|0b7˨n}.`;0 Z%hXH5>k9;׺'}]w]8' ׳e&z>uOS0[e+p X` D\E!JG}{(liq>nKVxxx2xx |?E!_Ikhd[>Xs7|_cC*%B\5@}QDH%/9% )_ #Kx9kxs\{BMe ;An o_y  MM ν~-z$ |M=A {A}?bc 8wɣY &2Q8˝iq?"5hǁ|,rbF2 gcl/4.C~}μnck0o|oxc% xV?~4ܛ5Uu*BC$$6Dx''EaS OבϞnw"bpE,[Ɂ z=~t'%;[P^٬MV'bG'_n 9 oc`&v_`n$"AuOћv.d@y `fv!YCzWKAwM9ew_o̿hP;&otǡCeE?AU#Ld6u WXݯ `"僫4\}tF7 = r!9 B9g/>! ؠ~ؠ`5;4 h_\jW78 hOOEn~wo#2>u& lЅ fXE/ ~\iO/819.zxbz`shYDYr;ڗn49~>z3 C> |9h\iG81=G1yF,Ct8]k6O2]xǶ7l³muDc EXJp}G2SC=SPQ\\WU`ZfXcWRS\UY<Q`Vr6MHYjXXo’[VމEL}@{=jy7|T3"S jSbj#l«klCmBW>`X}\ZY@Շ~3fe@ c >T߈5 XQ~;:4Ӝ :9^rr{z|[NtKaxKiHsyPsy`sy4y~#͏K>n1݄dus,S`Qs';+S!e R/WڛԓГSӪ'٧}Nӳgh3ZK+Âݎ|{X];L:ƣq-7qN'/t<@4&KFSԼGsսF=G^g:t Ղ-c(nw^(p%owHy^ BDE,%EE^nniֳRd8^{nEN}#Ȳ p;i;Q"NhUer٥ONq n͵ޕʵܕϵU5151Y]'ÕIM_pgq|'&6OȞkb"H%Uh=DkDvL*цnmxF lDFi*&ov WIR)AJkP4{eC8xe`'xCAyhq $iR8N3=cC3؀ 8$ 63XΠO I`0جEz _wpQxB> lxH:YNw@^U XHDv'݅IwW;?}~ Dߑ(c۳{^G𶀷95 Q8.&wiB+~ht ,.ED 1~cHd:'>A$u4|w8t#LY1 N 8iߪ<< < lDx؀D/Ȓ77oB>ǩ0>@?@tl fo4{ ]hƞ3r7wΆp>C|iL_Go1F~? :kX.o#u~Ȝ=G^{@l{&+l %0@ro!-M5=14:!޳$?0Gav 4Mhߡ3o4 Eyz̸L?B~-~ۼc YC6(l{/ Hg6y7jO8sYBۻ7a|EK^c!g0X|tdlm{'4Mhܿ@s=Up#nm6aKg0Lb<;s A&p3 >RpԠf N܇!2 9wC%zyKGGn??ߋ m3ޤ ](xXQ,籌O{Q;"?1]ssxY'S:?E+<9𣄮Q5oĈkOX3N`|ޅqq'!ʳt0&!g)08)TWDmtFW:xSO3x:>p)p.pD8>}$CxD`oUeLwu7]Tm?KWytY!.RUiQ=Rn*t\e'v:J)گqk[.uZ|3oZ*LHCƤi4[ePZ(֋{UU;'TT[՚'w<^ZMojj ?>sG? x"c8m#HVb2ͅT=o,K8(&uwjhVk6k5vk5hՇk׆Ѯ=]rUMZUWlTiX`Xahm0f`")EBqd12޻rvR-xQ\Sjεz UʲB52t2Rs-RKRRꬓR:RS[Ŧ[EJ~""m"D821b*1^> vgn|V("C+T) "tr ӲSL,㳊c3Egn̜ \ _#:30 &RHvN>%uiSB9u9p<eiG_GO{w{g{G{{[.k ^9|ؾQk`Xu :,M9 pW ($rP (dȚ9<`k0Bc Am S2P$rSrRt:  Q[V]e'#bq/Ny`@c'QHQ!'=NS>eCS) q*g?÷JLMUyS\%a]㉗8c_sF3|!FU# 0 ~5 IhyhY/Y,n#%2]R-őR&/b#,|s1Lc(HT4ᶗfd!"$GEtI1б` 1,p0؎!G"1@|&6fi>72qDu#'DE~vG|A@w|\†w `p"~<93mxكF%"DzTyW' @R~!X>da$#|~d!el fL9xupz!4}߬mIR"zFy$/o^Fr:7aǛmr0O6Ue2#yF_?[{y xF^{yxA^yU^xc ї#`sv|A;78]X[7^hJ0'?8[m=m氵ogc \~քxx HT`0|pb [6CflE-P];ow7h~ghh?=T߷,_#p_ȯS-ldSo`66hVX𦃳t+蓗'/Os2x5ǣO|LOCVWms_I2|Ak%US =B;~^:$t\wz?l*/Obi7Btp䃣 5h06bl܁>BNNgF%:8ZZ_,\'OzCj991?V DگI4 hMj&ڥIS{uiQgt6hYӹfu^i/hRwch'l{u[,l6,l:HǴ iCώx^`mK&4LhѬiy+͛ЬXд2MZq4fqX3m_ʙtL84q:9Iwqxp'inGv_m ^]V87r+W%'3ęqp\Cxn11{ؽ?^pShUUSW#h8*hqC~]ga+#a"ç돭%6B_ ,ÖzѤgǓ7#UK4nIbXCR.iTjt)5K%3ɪNrXT#$yL]2KR/FT“}E1l{2lَ4d_@z4htH}]viU"TieziVڦZ-WNVHUˤՊΫi㈄] ǍB6  8AcFsXu`3`K3SU6XPI# SfgZfhc:ibzPzz~)_&Mb|exH\R$vΎ*gNwAN |K[c6q NuʞjU·)q)"wU+_" qV+WW`[¶IDKЋ/ah2;0GԃĻd(>ACz.9$2_%҅FWTC ~H ЖӁ2?c/ !5aZx@Q5|΃70iHAqN"> m{M93,۳dg38szDIߡ??i; !+]B o^̃p#2tw_;nj0`dOp:Dwn]<[QGk=id ؘ_b2&p%8xbO f7Qs|z)ml]΢m"5:k5 `o)x^/ t۳@zOkěgcߐ ! ``3 @ΐ셐udfAv'HEEt Z&ow@ B46y/跴wIgQDྀZ jSm="?^ >4o<𔡥ZOx3@V#}-?+Eo^{A BW}E9T zpK~c2Gђ>CsOC?߼Vo`ˆHj+N|J7u_}a#Gca@WQ|SX8tO*g0<4'{C 0Ej0%vc>{06YX\A,.A_𩳰 z43[زxӇRmDaYHG8 QZ04aG/81v#0"Q{Bwtd>yZ^j|ysKMgNGD|!EG18*Qo ~̈Qp̢eZ^|rECk-mᖼK$R^k𺡥E'd' %੢5׽'0OV1.v"_ÿ0B`>6fw40 '`Lal?qWulM&сpiL{bh VYX@ˊeTCJMCIE43dp;qzr=E.Jncݱ4mq69-jU9Ϋt_n'̞Q(=lOK# ; GY Ö7@κ4jEn.^7 -owOⷺg()4y*4z({(y j<U }2ӂEn ܾa oq)a ё ȭ`ҐQO ziRu8p|<->R&pa$NX'IQd+VK *%JF2IRdDT$H|Nr|eyrtOF!kloΟI2[1uH%Ж(uJ}Ji< Q4 ]8 O\P*.sUfU3vSMK5yD/T}o%8g*/rF/ c~ `!Jf@֜0~E4T** W)U IQ V .HnH LL ^ь>tU3:Y5G0jQ2&E'&&G7*D/"N/P.EhU(Y3"lh\K8 \ |pg%VAB* ȿ^|Mɧޖ]9>< s]c]>[`W_`[ߨo]7˳[YԞ<1ycR3ϸQ0.gFe| `;0 N>;ɵD1>-DnmܮGnOvdDZnXq-3E:I{Ǩm v^)my!ƟHh3\:wt0 W5.׀.^.ɴ_-Ȩ߁ =H #H?sIvR1KWI5)v"vf0tMuD;!#>ꤘ'I4aA$ ěH#:tNLBsA@B C } 'c֚.o}qc{1 }!W-!栿#}  Ll{ff!VVl]@.ݘxs3#a oZA'1Zu% $>J$ \1FW_"D -رv/؋$d/.ZCp=!fW!PWǢlv'C;1ph1|N8R-ـu@Bz $GI9E8&qtq#G@0>Es薬v\sg1ar(x>{p+)_ӑmGDC_oHt6 iwwQ$,o/JSXF\G׈ 8-nT> {DD)˞͹13ѓ ۞ń{~v ^x][Ac.L ue"\·l!QFM?B)606>G@?ϯк> 8o'7N"wfNm)\]j.[u(l-=Qž a HGR츅 Oc9ɕ~Hv'i*Y4Y(76E>rhizmyu杠_>C>?e_l2t?oBs}3T*p4 \>|0h <>͞``:'(\C.toB:t/4fV14Г@C1?0~!D!x6n 3=?%?pd("Mǰ^_TYC`\zS5LߙM\^k+f>%xUi >[y/|Q Ft' ;WCh{X2VS tz(o ~ NKp:˞PpĂ#"^kfpt#~aci>+?3ʧSӟ _k N[yO t:D(ਣ}cse ctd7bMe\Ջx#l_ZY|)]j/H:NW0xG82ډN3 ̚K//ittY-x{KXjO eaC770ā'<cD]VQa@VjK-l]Eۚ~[mlTmévSf}9NgB߸V xc?4lXu+R,3F`6u5.{{j:s8zdnc&Ʃ[TέtU8uʜy%N3"]ǣ<ǫǧY3n3 ;^(E`ڛ}@{:+S!5m7nWįrW'()*(y Rb0aO0'Y1'S)ǧ@)˧B)çI)ݧG)g\$J9((~\(Q#vgX< B#HvtWϧ-QԎ[$uK}9AYx崀4Ԁ\dRq8>S?*_G]"`TB|oF1p^!:yL@k-@>SFaTf sgz CRB”c ɪqYj1EQ5maCj!jAAjATU |W'I?0D`,DBcQМK~VNT )/Z(#ڑ!HS VTHPH(hѐF G̩FIϨz?, {[3Q UnHc ? M. WÞA{ )#AR)9ўƏIFqqj~&u~5Uؽb*n)Ƽ%rA9;G; HH/ʀ|H,穩[njhH>Y7e!7YY#4yqS6EAS5NS9i5F06.J!R^ Q͗\J%9p"P p'AE@y6B@t HKHˊԺIE*]$&Ů4vBW=q;!;!b;$0落5 ioU@!w,$QPtdsu7q`<ahalrX܇ a Cv,z܃U@ 1QM, -k bǪwb3Q8|+xm Wϕ$Ma<ii$3c ,66NEc30z–oY-LfN ׅNѐRdsH4A Kc v,#;L*&**\ q AW34_1! 3D_=MA$>/0pCh`#?wo(8{z "#/x0g`gr`ϣΤ > Y$a?1/bP]h2=_6BT9!&ak 9$|*x,)ye,%y=k"B ?ldx1t5< }(G?5t (L!?:cg0'$繽u/l ak!/?@w`>¤}y {Ldvs.|gٟ֝([l͜S{՟a ߫̕n"7wBdSoO!pn=p݋ M$l4wQ~fYS @߅}MogP^ o2 y3\iɣn>R}LB.[Prz5LW0x_Z| z}<$.|h!ށ|ga3PO'2C*bCXy"w/Xn746xѽ^'\H~EhChw;_T9isV܃^ys\O/.W8~I9&Etva4o8G}hs=0iH'"rd9ѱO7x6lAaߒ'>3p٣O,RD«e) :;Î D~O1>X ^bTxcӚwo.?*|rfk0X{Z[6D,+f<^cڂӍƸ~4 a~4 *$Ҁ +,au S:MqZWI05*^zǩV]@բJl-}Y 撩?y?ۦ4C4$v~U/URF8uiQV keQV!hSv=5jSLS Ui KThO:?SBmuqGߟ#d Npbfff[%33C8c;0'N07i sMڴa6 ~ uy?L$ofvvw~ ,1`i9 }9G;e{<%Rd]D,U"AE٘IE1da/1Ge,RY@h/!O{g选Ԅ%t~Kew+l"%%kde|,OȐ%2T&jdQrL'wʂͤq\3a\3Ќ7i{435kzN3ڎ/6]{CL T˂+QX{koe,K 8IO9)SfT75hGmsn<4/zu]NvV f>7 vIލ9Tyxxm5,Ld(6j,U7d)Xj}fCmpLuXf,kZ,;ܚ,,epɾ߭*eO+3~v4좮ſT|ҿHv'~94?'|d.D}\}itkֻYǫj{=s^-3G\+7uX9B (%>k7Ͼ tWJgUU5UZ{J)6ϔ ړtx1롅Rd!2 =AڛDI[5D⤢-USږ+j7X[KZk9]BlJ\p62Y 2mlowv}; R E=QRГ$=fMnO.X]e0w7wwut/6ꓺw/vݩ|V6{}dbsc#ބ,s%V ¿|2*YCq1*,MP6e\<ԠK% iㆧC5C;5C%bR ]B$;MHMm]avu8b}8 ؝`7]v>&IIĩ2ITLKTDNJTNMI &ɼw{\Gow&6qNo9 v إpIx%icSg%t6Jg$h,s?W&~s 3%^c1;'n7~Μ'HCk\?n&go@C," H؍]mNdBMPhy j/X,nE(U]d _8ܵJ5%p* ޽fg(" [pHr*/Myw3}3fNKK~7B"7@׽(| Y-@7_Y 7PtѰ$k'.8.8p&=豗Ef*3ҩ{1d:ރ$sA[^x=Bw 6Wbs>_5PD_^Ar*z" KroWwWрKKa`&g/jĎ6zd }>Y/Vr]-sef&52CMi>)72Y{XraT䈪} "@ٮ -hhHunYƽ@V{JZY,˼:eɬ"Y.>dn9]&|˘  0~(!6ɣE0rJ};m潍K*Y`2T,d&ACeaHLd]*d8t &K_uzt(KGȏ.wC")a}F+~n䵵賊dEA\DDtT,.ɘrAY[#=qۥ+T=Wb{)iP!ڦiiT L=1:kg ƳɂHL$$Pr &Wi5vMOetg4ƕVMx>*mmUIh+U&rW M$-ކCg~"Zg&Rd4-Te&}&T2k;Lvsܭk6 u :&}ytt4N}q3ERlvQTi^R*%4O2.YAғ#]FM%Cj5[JM*}Pg0Xܪ,n%ne n%nEnٗ0f=m|א[斋EO?X?d92L( ~ON:K5RZd5i]Pm-wֹ[K}qB묻պ=Ϻ='L7KenYye=i0c0|f3m牜ou=YS> ^7{K4J}iԔjJt%ҒR’fQ5%;3J/1jH-zBo,|`,hm@ΡSJpVdBy D^W!UARY-eUɚ**Wo*2VU[ݳ:3UMUҪvR+/'UޢKx\_.kC\-~%G[8<6!mHyMHE^JKQC4$H^C&![Pl(7 ԆACJB}rJ}bv]Bڸ17kDվZQeGT *:jT 8tT/R m+k&߅6y-Dc$( MZ{6T^Klo%kڧ+4[5m$B kIBZ7$+MpMTo]!𶁷 E P_Thq^1FHRo$I|Eb$E5KD_MHhR ,ſu(>]wk/m_Ms.2lsBZnýDbG$j$H"F$l$IBG<'Ae0Z/G;wdDGzq'E7thm_D{CM8΄"}@Hvm;;>0DƈBx,b t [D@lRj Sp)$e,i9!$4["HO>ax(uOaD/q_.,KYh,e2]jQtNdqdr: i\ qyNGdq ~N~uj"H` eNψC[+IpV+אhϭeQY"Imm5#Udd'XGP qjߕY?·z :N~~[$\L|;;P=mɭd7~x9.D]E0k܈ؿ oW`$tL*>؏ǁSb;Dч!?U=8=m(uBfpM7j0q'I,!j?=)G藣^"H&>!>#88vz8<8σԟs; |8R5lY8 U>tl'<Þ:j/(l~qD @`$?kcН'h:5qOd%6/XpU6`o&j <'ɵE{PQQ="$ʷCJbr}|/=BfBސ%5NTs*sM7]"܉窅$A\Y:EQ! 'Oϒ<"qG y.IG _!q6&v0.E^\PN>8!ڃ򴓴=!q.!EK83>\fK`#uv\ g0R>M|y. m- u餿W) r@TC=U"57xxq+k.p"_ s[%zF 9x3xp_k =wJUR8{"2eūp̗깬ϣ3z<[{ =q=2q{?>|qS~sP\gQn0ŲunZ,[Yw_(y9䜂w. jy8qzIkIS`S N8 %;8 iw)Vڝ5"}Fc#Q=a d)8SڙAwU9z`l`bK,ZbO)XXV;=` ,Xg4^Sxtgu2#~?a0o"%%J4͏6fxȜHf2EY4˄aF +e԰Y epT IV?&݆ץbU`!Ai,/-LHVJ[.e3Zf2) |eʷD&|eܯQF>?*IYK1iο]=)MBF?](R SH dE,9&Ϣ _Y. 2.#! -  떮a _ ˤ5|4#R~Ԇ*aKU[׈MB3I5.QGI#)'?%-[.|fպEo%YkoA7MlXMm_#*dA & iA ER\+_')Ki64OQZ3J[}zc.t.t66|Mt%Q6 9ogڃSR6TVyJvUdUGIFuMMJu6JXݬMUkch7j"Os%W^+^/$Ԧ *i`n*B n-%pQ ) i$1L$)E⛲$*1M嚨lQ mظOkŧ~{Y|j?ķʦ9[,xc H%؅> h ꈒD 0IhGwHPGt!X$^kģ}Cەk[-/14}'FQ8:G  xT).o^}ſ?Dcķ(o qo}hV}>S/ )w9uAv$Vq_ՀF{A) *E ^c|=FǎXȏ!bσi,a :}?U&|< H-إ`E^44.ypix"E,tL1-"ѹ[%Ӑ0!kSI 0lSwDBJ*IPHpi~RO&ve,UEf%J}_S|}2ҫHڒ(gـPw }@l\7\/(nd Dg=zl@ =6';6>nO61d3 lmgn4's]O GY5w ))Tpc Z ƝlA3eO In=,XuL= ida ^{)jTF&7x[\x⨿QCN'!<Çd8J|E$Vdg8=3|%ӄһqN ~pCB/WK%'E9W {M\D\/r9JE@mFν_\u/}̥.0\ՌElFQg;s8D̙IL5 f|r~.=8n,;`?L#.2m,بW:ڇ D}&UQB',>$i: | _z_j0؜F SzN8\׾W-'32:\ ;$B0)HпЩmG D=E bȏT_K7`:) >%!,}ʻ p_頿$O®ޓiEg g V[} .9|cwN+'#z<2xf< {~&yG=7~G;~܃qs(yaO_39i]@GlEVf~0vk» OTCJs uȋpg%V VX)vEi# cPYD$h{#a1ͥ 7R?U=A8=&{0_l#Lؐh 7~ma}rjl?u 9wN fC%9Ρ*^@l=8*"0*;iioRv;aۉmOo{l"*7o=JT= zsTS@p!38y\,;z0Z~/u2'kUJJZ\Nd,Kz__(ykQ>\N/OzlŞPp%,t*h.pGEf"4$&m;fUUeKԑTLktY-u^$X`c *Fpe!1EL8'^f>FXl'Fh 5LĜ:Ym%E[E>+eK$Xf3d VvTW'mWtw"z3Ýc O)o$Dzen3YsG3?&2 ]dĐ%CnVt+~jhNqi\,ms4yRqBjݙe^*C=RuAː^7r3c2$,3?WÿB5MZz)pTg.pnCRx\nhgȏM %5?/F}׆kt?D'+$\:B-4MZò9*^#uR-R1-+$bE*K~ X^AXB\ Q&*,#F}t}yߴEyKKt4HCQbR+qERW)qR!%R@ K^fɉ? qJfub}@c|1E1E4wm 12? !i]LC%HMRT%'JEr%gKѪ)2i uMg'5ƥL&x&x&%ZMr5Ij~$۴ T{\)cf|NyJIEI)N M)b5ehLySbf[^pJ5t7!5XK}P&4Sb$&B"k%&MBk%Pj$Eo͔x׬Ϛ^}.m孢xJo+1T7 IsրKR vn9H )Ѡ&_ lhל,fn2hnn7i"FVVzAR-W8Qvրj2U; zW#N1t+^ N:c:ܝ|۩.5u@!mV7Bd'BjT i6Sį[ĭEvm|01 0h/ 3V~[?,Aw~-,ſ`"H3EK&',c^d t2ٱmql/Ni& ddFcdJe+~u;.j~9k@)=pCIp2/ϰ-fQeS->G܀Yb̥}N6>EYNҁ4 e؜|=p}$-L$2,+c jXz:y:t.]?sUd+C>YbҋR+69´A/÷Ovө1f,qBBN|# YAif>`sX|% \׺\ Qإw&5,<$a#,(Auτ?N;>O\OT5lnd>\u {#k,r3V!be4e \u!ep q$/Od{zB8N~'.׽ZLwR/' ށw7຋μ#nBk2x_`sq؉y3ĉ$'ת #$, Uw9yB\dT-~/ g95 Ix-5߽υUw:z>wp/?|Bd1H! aٰ˟qK("Ly8P?sXyK D _pi>K|(`UF *zϡx ~ w;_;0;IuF Hށ[ ~LT{bG-̹WwQaL?E3LA0dI7hz,J =vUP@lF8#$02QN,J waK?m\oտp]Kly/P0g)_T8BxVC `ڏTϖk铫Wgtv?t 崽g1\TPbQ%PC 11i?M螋wia-XI;BSr=ĺ> NZ؉Tq;.&66GCMM- 3g@i?3c,}^؍czl'>†m"6TdXA.:} U׉[Mê<_&.vJq`jV0J ׃B]?@cf>Y'fe9L\*E NO2?r:U|}Њ8 N"x:+8Tɜ4 N7=I52n!f 6bo}ڹ䨥O-j9VKZWeV sz8e2!XN;QGxdmDR'QnmW"6 "U@N3bZ< /AH+~$h&tkDPԆΗ0 ) ϐ<)(jɏlnDJVbɈ\'ݒyDWHR$}|/6b AWVn$>So) h)MtɍHN\dUHV|dw)~X1~$3%.rCbAޗ8YU"EڑF*y)H򐼤IKrd%J1SL|I7iRu]d$%θJb;%xX“/Ф%$i I|OBwjA ҂!H R{y%3O̦PI7H)YRfI6JDoę[%< Qa^)l:CMm+S6WEi@R$"Hj$[$) Il)Ȝ* iМ> Ι⟳M|-wEug=*gƿl7؃ӂBˑ"$I#͇X%`DIDA%0C %\ e~aW($nEo=_4y&5|.wW! Vv:iq2)jY2o * H_(~S#^Q^+ne/mġ _F\J^X ƽ&RN~7j ;+G\$R<46Y)2]j{mjcE_kmmhj ,r faլUd'T˿@e{z Y v: `GABkDD<D nfiap0[ZJx m5CYdJ=De#j/_UBr]PdkYW d2 us{=tl:XƗzt ].HKKk+ܿ'Y Bpq_kÍ}HY66?MzBu'}Z 2H#F0b/!!]|O8xI3 g (a׳$#Y'XX'c}I:Q읦4_^H,T S 2OE:t}8JJ8e`sb<p$ !D%=VtV1W+ix7!ˈ˥%$ `!m> |="F\ 'Ԟ\9q&\!$"I:`IJ`ޮ?M9R $ ood܊͕؜iWچ%NLW(*z>9@"vjcca&3c8=BLUB~Yq]8q nk[xPZ>O.$8lNR w>'a|&ǵOC+$cFbVۙ7na݌[h7|EnxM5B|q>s@'^۞ SU]Bc^xyIstSĵSqo"3:iUu_A\{B ("wbm7&>ߣ&.[K D݋ꋄ?~"Nj+r/ʇd3HeMо  U8͟a,/a 8YS0kG;NAZu[g>& kWLzIM8 x}wߺNA\ACa(Tu zFlJs#l!`i8 tv ;/IW8`:Ĺs }ڻB^|q.[&\O\z-=DaĎ粞ư9X9TPPqͮ {}v$m;>(lyq.z`G$Jo? 8Ӫ߹B݃ŢA3ԯu Zˢ}+~64 F3F$,λ0vOC{06!#f=/9orb 1%gӾK0Z>`O,gz(+r[Cjk?`Mʷ] 0h4 ICHKcOY K8I,-Jqi}Nh-$ ɺeưfxgBdy3>Ƹoe;/WcJ<$ 1!FcMPhM ij0D P$Bh sI!҅Sm|<\::l!66F.!QIӷPι'CR{pյU9y/JN0 ^f?qzPmNe<Ġ?D'Q1dn{Ϥ7v9}gv*LUr]N>Z<g\.L1|2D菣oK6 1wDcUN;]uUq݇ry 95Z}/x3u N/`^Gi<@p &qu-uw x@48]7$W&0Y =Ȁ}=!B(ɇaMyt'wi'U5uT!^y_<x>(ax=E{nzF|qWDY(:kj:̘z:{i[=%.7~-~9WKX4~G IpfY:`'ԭ gPTt WCO;6g]K\\/^.qH*Mx0 8rq,XQXLg0HNu?ł="jy$UsPC\pGwڎ@h?ȂuPFLUB>~W fh%oa*=m3'OsWJd[\;ӜS^a7(NBLoa~);aU p:Ƿ۽s]0W{/\0G|細9oqNkjGۡCɴo} ,z,F_/ ໓5ΧGvpHg 0V{0[ӬVrReTg=RlB}Xᒧ\CX -nV.&IsIvDuGbݏIUW/aŧ?Aҝ,"Ķ8h{ZSqo_LHIofIU~ ~]7*f%r /!~H5sz(^ _~_b'? ]BJ+z6gSFFL/Aab dI6K|pJtpDtHxȰHP:'~gO5xx$w'qk!xM"A dҐ>np_؈(LtHXdDHPdDʼEF<#w{1D\!EB}( wP^pUűK6bT$Gbc%q.qq"Y_ 7E#~J +D]4q$H1wB`YQ#_Vuu#c`uu}&-@,H!H<kPې$w 41D7%ISL♒')eIEcT,s<<I"1L$ Lx?L~-}<~{"@%P<$"F`(A|L>iw:`9U4fU0!kfhi yY1 !lujO`~ kIH!OO^,^0sBdEf7 fp< VDً;?O~77~d!F$P>\h -p:i/".d/`)`%,`U!XY)t Ku4ݱH*&gAa`Ҵ4 -b/aR/UWjCTKe uB2R RE2JL7Vb_Q2\qͺC5e, LUp|Q/MVF5&xf#ב5koD*2يe\Gy^B=D,I|iP hvsۙ;h{RE_+Bh(5=CMkU#H!{])>U?giMa1c!98ƍU@!CsB:0#lҋ}MHE#ru*kp~ ٓGj =)豘q2@&ǥiBdS0r0 Y0|M^p tbj!.1#bIzHllO6 Xk'V"Y#{]<~BwժP؜FlPgk!*tSO(ξG]G`ON!ዽybsbbq3sjy>6ѿ1$p?S%+BNOE?.dw:silc̗G3^fUJa,D5{ݖ8 Dugc\uiu:;F ߈/qס0+Zb v"kwggq~}6wv(Ì|χy(|aXwKY`ǃqzF|6F#gp?\:"2E_Gc.} -~_'~?=? Db=2AʹKERN5 5~`LsLه6g1^}b̈~wa5o~5P4JEhP$MId,yBHE*$)E8yZ}s}x>g߽y5Z_k RuG;Sel0s4yldA,pZcrm rY͆6=(S PtQ7a9`9cQx:SLLq` n6ZO-ٞgi6-D 6-"@ @(mx1O>ɷ.` 7"r X2KM y( G,1<`@n+Ԩ%zcF,02Yrl9` X3P|flaJzBt>I ag yf7C J=ᇝQM[_G_;eς>="\TkW3=F01%|R?@&#7hYA=Qs'*|A`:BD?}2:PD$ͿX, bxgz=a#$NM!%.FԄuQ6%}%a{ Fdp4^@ą DQ"*p=Bo@AYn/,20ƵO !*D]QITE%#֗(i1"'fJdz[)q".ADŃIh""'"/߳"lY5'x5}ei~$-Dň,Q&2DR?DDe-IODDօt',nY>8aR$H\vtf {"w틱"7h( q_ W#2 DJ'W"bJ\XɐtWJ$J΄O ΢c%~%yA82A =P6-@ P=%@*W_"*Aʑn*D@M!HVcUGaWE@ GYud ͠+ ׼/::' k 0BCBi:7YFAhm6Z0 kb4Dܭ j7{2F"db~dS=E@גKam"+,a\A>|h}cQf=zua4? 5 !C{õ$@>T菁K!b́hT&$[D41 k1av0SnALBչ:[ dkmUERxO0[jc nØCـk.ϭLsVb fjN⭉Ab`xƔek$ =."!B(<l1Xb 3lKpbQ(807`@ 3%8SΞ0G? bըi}p-Ą`Z>\3q'3[6aw@8P`,>pT.l@7[c:c-@@$!&Laf5).1xIr}w7Ɖ0F!Pt==օ1:coqB[+BG9<hPvI$ pW܋gbߊNs&9olkEO v:;sYxg b?@q >7-Ȝ9: >b̎F98%6pLy@Vakpn]rs!M߮UhQ'qAi#g,A},D0mb>ܿ l&tDxru.{rr!ZMnvD!xA݄rc] A2uGEyʿ/x 5!UayaǸq< 0LI'$Xs %1O1qK-bKRrxW "Ĕm)V^C`6ba Gي(WTsgρ8 $G aȂ=!r@F sLkP8#ek@Ei@MM ALXizI9 V} qٍHy'b퐰nƧ7''= ,fl Kuk{9灊<9Dͪ.݋<6cc=G/La[IpZk'7 +gE4$s8ҵ-WaŞG564Bэau[a2`@ e!k`QN2dGٵk [-ٜB*4PZ}1Nư!k.:yB;C&oYv\6 ME,eNP (C Q ua[|X2c8'sSB\P8Ԟ3ZzF܃oF<,]{&? %9@2!C@/1V@61(nF03ĢE!v/ۧ&+L6u2w 0n9"v !Q:AYq0n30cKA B ԇ1Ncf0ӟg. sW&>YQ''D р ]&gGղ"h5`8G+GOx[b6ٞl4*2qu1:ĸe:1A01}ňMYF(Wj4,F"5r58v!/%}R!=[8 \! `M!2^YQ2Aav`)?$|*7Dܧ3'l4R;LoÁ!ܼ>PF-~A^dɃ2i@z E# -L'jsђւyp+R38q,gt'7bS=U}JD[G7Q!D^P jYA"#hJ$"bHOYD?% Wِ==!Q!HoU =@ PC}^Dg7"Cȉ"2"DZDH M".2 &DHG"ÓtFD=VQD)gO!G(ߎ {8?$#eHO>GMH7qK"(nO%wKljՉS$ = +2D;> ah.Jx_'))"!ٍ"=t/"e*!|dѣdˢɰCʠHcD Yaѷ$ }!YЇ ZP. HIiA[)ۍ AO()Ћ()+!SGUa) O>'ez@_nG})Y".'@z aA"΢*QE!Jdt5!pQ(@/z f8>Pڝf}PPE2Tr"-G  #*4TѠՅG[kvpO^[Мm b18P4@} 7@hRAK? OI/P⃯82a9 @2 W9@ E0 dFNR1[lawS)FxS S@!3/ԅvp;l]XGOQRҲrJ}kjio`hdl2taíGe;y87w^>~!a'EM:mzYΛp˖[zͺ6m޲up 19%5-࡬9yG;~dQ3gϕW\Ru+W7h|vk{>x_|?}J|Lc!r/,Δ Lma`fL{+o0 2xA `Hf)3`9 `%+5=1E3$1(*0K>K!3iX>~~AؠгW/Q!% {" , ,1 6?cf3JI""L5gVZ~Ӗm;wݟzK~\9J2-&B 4~s(իw>iA, m3j-cOO{|=?ci蚗"?.ξwnZQkɌME\;\sdɣ 9>.p?p?~82EN_Ϻ|*BU"sګNTEW]+rbɌ[%e]wpps[*/<^t9v3xb.8r9da -?jG\_x́s/_ +q¤s7OOoR8wAs8Dh.qAJG猇->ko'\t|] eyU/G]}fJ˚{ <s-Zhcŕq3>\s!Ǐ\;q1r˛EX^28K\s/6Ư+lns5c5|m 8XjȩUVO[T}p8G5>=vWqӯ?u_U{Yyׂ w^9bekUD.h8Ghڛ2:{{ϝUp[y׎6䔛{lT6܂3+#8CԗB+Goioy/]tߚ~'a--M[|5xvmp=@W3|WbާHwGY\~aY1뱋2o{kw[>4i+v-pkߗB_NK<;o.zJclǟ9xc˚{Jw;}zO&c| u;e,v0k-4/aYDGaIglxS5K:ݷ}k=}QwL@ n L]|('\0nh(^LZZVȀ6jًcsiz1m$;oe3Z74.=(}:tjf\MG.j=)̋|3va+%/ݗ\'wW#Gjj yo(Gj'RAۨUlj3ZDQEq9㸙fy~xp^\m%^k8Jdi?t*:|<:s!:П v^qx<ɝFQɿ $HӵzTCdISmLhH1L gOΔŇǯ<ٶcmYMkXP ،_888+ p814iHc8u4G7?ϙԑ{/ui7w|}ƺun&eIpqH#* Ko\M]st֎ջ;/wWA3x i0 5ˆ8Xb/%ޑJ;iYTòĔDdqhэm:ld=~=ZW^Wm{zqbIo].0ҹy g\ٱ'eU8 pHϥ\ߟg=˸u5I啕SkNh8R2c8=~w҆_]fPF]} 5eŕʦ\O)䜇kO{W8ajϧ,U:佰ہ])8U;l^UŴIvܼxڽ-9;RPUZ`;W=ip g–>[kZRKoͿz: /D\t.Ғ Jݞ_AC&8}q~o̞]%mA}6MAu!E 5e۪&\\UQ4qN鼦٥q zHi&8Ze Nw9psө~rꃎ|fݥK*êTDT̪^A3!  %鑡}ޕXk?=N]cB7ٗz/cwc O.tv6_\ˠY%D %象 /*]5jzhg_1Vg<ڹ'yS_ g\ :=vBid͔s4[h CtT[)߼3°hA'?9z,c{^ZSdl͝Qr<~҉_͑yiس!ⷛtZ,ocgr\Wغx%FzFnBZ2ó'2h,=)}+DXf jmIGz%PۈmWx!xz)Zz'A2>$/(5HU= VX%2OXlf+g,CGM~ZGA:|^ <-&huq/xE\T?hLjcCW̼MO#iw |42ug= c+n\[[aˍ5O/KnΚ|3enF}܃u? I")衴`=DPqO$֡ og,9ߐnݰ[n[zc?qoJӇ9pف TԄW&}\<=މEG=,~͍c6ݚ@%)7-IIr8ăCp=7z-trz31oKC^YvvFQ}ʜ%iq c_Բ~E͟MdpH}hSZ4Yw~1.zWQ͕O֔)/= {[lj߸}ʵZWIjYC [/ؽ/w{]3YMκw'f]vޤC C`ec]Ө5>O{N{wn-eO|.jY6ϻpeoJn)4yGhq^Z=\yߞC'ÎgFWM"nEƅgݜv[Ӝ5,CJIzp"ͷxwfѳj[Ǝopnz걼ﮢ A CJ6_ Z~>ܲ3n)[}}ZyM4pH/A+|9abkܛ\mi#m~IMN :ௐb.LS;ҚmՓ*w4h,?MWi;H) Ǘln kttyUeqcM> Zk?.hVmPitKSO^[^A!CMf^Y(׏Tox0K{s"O{ڽvmhI^5)'&օMUZ78nyQHݪ? zPRN+6\zSҏ]Q YfbS=kJv'#/+)8')"7izn@ӂ%? )GԺ~"O+En6ylU~y9 b?u ]W>v4y t'0NX_$;? -EhS:uz%Ͻ5.2>ĸĸO3b#IOք=!&N-[;&n 4hZrO[2`b箢|?vw+v+"C 0C 91tww"`b }~gq.>5쵞삁%|Z hDX%-Hː~;k|WrQSsSø)gȊsTҼyiveG9: *nf1}m1 isy e%²*A~c)ېH#*W/ʂ+Gcy XmK`]^UTOC0r - :2 + R+ z׆[7"7#K6ݮ88s8ΟqK׈pnq]~5')-6KzVBqnO!D{dDFFC]r5Ġ 4'K5rg _7$UYW5f&zeER&Ň(䌇 1hC,)H\k^VGv.lvđBnGmeucK~[oJHdxHD̄o`;m57 wv3 PkJWl2cA>Ä6ܦZ\Xy$ {;6)9: )97 &Gbц~JkE9wHK}P}HnrL~|G>Ţ<ؔ\*km"g$E^bW SmԊffwmhCe,r$ gA~GijBB)G嬻>*{WQ>H-y:6杞f}&]y=&wCڐ6d=\v[+ O^ |虓YN5"iR#5l\sSe7dڋ018v% H>lk ΁Z#zy>9<-"]\ᗔymZ98j3L1"ˆfѐ^ ;h[7Q;Q3T7 H=Ү^-g ^r~G9+$P,Z,n1/H@J%L-?o8tiY 1ch7@ڙ-su|S;b=vݒ@).vA8+Kv`N)JKdZ4i/lij/S& 7\2q}ۻ?[b(>QAP'hU㧤 R?}m0Ӳ/yBL Zwe9YθFq}C} 5lF~цP!XU698-;x"F~HYYZ}3o`ґ0iԕ8ߛ4ۓ^zp3ڰ./! 0B$DHC6"9k*!eeQgiBSƤiKQ{V^[v~GzA6^>>wB0 q,T-](sd/ԏ1Y3ib~ʂWQ\CI3Ψ5g~7 Ahc 1 $IJY52_r4KQ6mN1BuuqUM#ڸܴ` ?NC$%GTq)J0Ɇ? sQ_}|s\B_>Ik-j*kl6+oė7TX40| 2A4EHib)/+{ې(O(#a̓-ܖNҖBBUMU]zA43 Gl#+1g-#&1i[ᰏwMK`K9ѹԮ-˲-ͺ>Ŧr~7 !hC(zRyoB(JBU]yƮ-&SRGc\ <[Zj;ɝyN) veMqU56lwCIg=i7 WR|ڷRmCש'6)NZ؞|ﬞtr~O,);ʡ5TQ^6D hC Hd= !_eLZ{**}R|48ʲ0?t>%/'/%/ȩ#ȹiD2g jȽ_RB*4M4>6*Ln϶˫Iq(qoxwPD<qq+i]7 iṲR"<_#)YAy]Me0<[IJriL < Mrd xzD t7> i R0IϝUj9wԙ&֔Yۖf86D%vQ#GܢC3lr} ;wC6>OB!Ņj;3)k:`ZKkͳ3ˬK2;nD!!ۄAˈ~ːoCp0dX->?_/ts8׻2ϟ)HC:ݸ|frEIDuwm;)ǩ&wogm[Ծ^цH!!c9Xu[bl/'%%OPqhŦ2bFjV nBwE5˼._XԎ,m^/Tmuyn{qrByi7vjYO0ԸGiA =*&vVNV|OT ?\ք[/AbІ{!{r{=vGq/RU3rwJ^ S!CZAzA:P@PBpInOmzA,K/|]?jc?0 swQ9qoR_"f}THUGuuKGmKF=J0Ê5Ҋ4 oS[viJn2{sms~h΋FK|P R3TK}yf2CSst4} ȹ{MCW7a6qj^*HJԊQ a2}yяQ{cƖƍ60ZmLzA rrr O /mjxjbp0'@6Ml%f?d fݵ*{UKQd@QU^@ۅ@  #cۑϗU/1Ir7x|SxTl_-eT~+8(Ē;DejmVdw ;Ƒ$u> f6'/h | SqE1cYP/ z(#%no@7"7# G7ùIpp\9 7;mf2f!m`TN9Q)UIuqS% QPmm A:{6!O7"pxs2t, .^+&TF>9`vQq> aQI)~P@#U)^HWW!|ی:GOX8s].2(Ufig;%,< \< |\ b| ]7ݿNGypbd>F@ we pS; X:Z\8j徊/Xz<^? {>y3;yBY56أ ]/%q 몂li4}$k$g٤wɤdJeh`0Hhfl]o x䋇txܿ  ૭x8l`,5YnYEؼYSiWĴQO+qڃݑ?.@\nKs B}3TA0@1­zX vVa 9YҸYfm; ztS:[ |4\!r \Si%gG y|w fŊ@KH(H!T1k7jec;2q=)hmp< yT\j(.F 1y~qw !Q3r^Yd4/-xfP8hTnT؀kͭ2L+3M^ONBOAs}EAr¯X\͗i_)W6ㄨQBj#˂҇u%] % |Sai{Vym= `fC_v,p_$aU Bd=xLכ`R3O>Đ^b|EMVE]yE¢$Вiّq4s_T! )ޟʲziķ/"G]$fFZu=ʡX]aY[An*L! hυx8D3A"%H##WIK.FC6f=g5D%ԻTT:֖9%ԕVfW&jmKb hCc| R.B ï| "OE:o ex=L!6WxVrܢi % I QEAhCBn8@㼰#xgry uWzƞ2,#Rj>)aII ÁNN v$0tsy?J?JSzQcУ'"1&,ZYO hi l )nv-nrrX h߅q0$1,7*X?6ʈMh>i"<4po/2 ɶJ,LIs. 'Q;}R: ;=:]ܫ!!Ha: 9_Z+]ZehEO֭RV@HβJLu( uwos r v ($6T֮ڰ z1s|MLo=WV7kou5 *(3ZfFgj]\Zm].븬Nvf!vnLC'j.t0~$3XFicsi~`fql|YFHegM]:ffjVl_ހ^EBІ{!^a&љpyHs}O mpBl3|ܹn0 xYS dv Oq^0te(kިQw^ϸ!Cgڣ5tka+8 v玀 :pc:ޜׁ" ~Ҽ~$h-9L$ys/&!8o_ׄ|6 }{715٧(Co¿Emp9,q^@AF@U%_,旻wG;7"ЌIT|r{\;7F-qq=#}=:qmFѐZx;68 .O w Rk9LEWww"i;ip$>6qzS'Q|wj;E'7[i4Qf(O_ s|83A(% 1 Te:_BM)VoH~/l1sJCaӤAjδ2|oR`Lpnp;  )`1ˉlJf oB}lFcxzAYvVB[vi[vY-ۢ?!0'{ 'Q{Ai ŸS1qƓQfcAD^N'2ɖSG ϫIʫͫ+i&[gZ$'[ xhC@vX3~%'4V ]j?"'N]\׺Ƚ0<$f`XV@wnʬ D;K^Mj=Xϖs xe.fUm2BBlD17ѾЙ\eUO'DYDCjL wv\ ,;sOD:0UM5zrjiL`.F ۤ8T%ט$SR񩥕 bÈ? 6 WvB]?ʘ4s|CC .5mz}*h2B\\r\^H.?ԠXaڲvmvf\޾ZpsZƝo{xz$/}1G^ RD/O7¹D12VU&j׶hgju ~hCmqqBٵ-3<upH[뵯Ex K)NF?RRt ю7ҧteju9eb20i]4dھ?@!6y6^09xf+9}YA;\k)lब5Im!Q_곸xyqʓ-JT?!ظXzy׵<#κYE<_b? I4u7 }(LmҴgtxLjLiǾ!?!F97lE"373)B>'7G<U}w sw;ΪdY}wY¬,?&=U{̏N? e72Ql߂tmC/l)^ߗHr#hsS#k¯[jJUW,Tuee2KVKTJJu$A6"ٽH1ߖS.\sff{m% }B+닃5V WWuD!另dA:7"u6!Eppcmp$n\ p ̼p_X8$GFEA]䕄@UIPQ,<_OF A)Mpd?g&p.ܸX.$6!a>inP5N0; A#H4l}D8zNֆӗM|G 3 | ,]87ς)% pDV\I7Q;mL0qF*0^ծ¯hWtK:&گLj1jL&?6hm0D˻: 24XjH @xEtY'|I'bQ'SfKnռWZ/5l&j~$ k~2_ ڰ,=$(p%^U TVL,K8'OpyzvszEsz5zozu:ļpW2֡Okأ5cݽc`y$W@g*8)/Xϛ[<9}R]>cS>a3AW:ccO}1/oZ~7ؠ Vg@} B+ "s1 I Z 8vG=A޷Cˉxߓ?I?O<22 pnuq*wO,Oͳڦeвii]8@8M|a+ ${i?:-$s&tc:[U8MKc0Ь#̩>R꒘FsH!g&;fg&:Vf;vdDvd&RClNjp~A$Hw'Kw/eaz LcLIUaVv^NInT(p6TOqx h+>A2'? \*X^`(OC#k\/slR^ad |?r~>Ž>ù9ݩ#ݩ7ݱ/a-c+2^bo]186]e|}Ej-9FU4#Dstuh|]|S:=333ūX֚Cr\{.vn7v/f0Zv]/#52]e*ڸlM6#928jO. /JJ,} ^-yVV] [mwB򍝿rTz`DF)j%R~A:-ۘndkKs Y&C[~&-6PNq^aj=^nlhT)V*ӱL,¹F2̣]SRrLb b  p+V!'פZs ,Q< 9扦9،l, 4$ĵ;6 6/_4SsuӋk8W?"R< %ѭצf҄qv2(33(H)qL.iťj`*55sjf R7ub3m+=MIdaÎtOGŅeU|{Tm;5-۴q(&8&xf8XFJPj0ՊGk/?r"u{G#}S6eUTIg~2V\ T}BU”G|BRC+>nRT}BQ|ٶ BomHV6ÅMUd?2};?O;aq-))+[ /ս_x+r{)!]CY3W.km!f:g2R ٌ4܉T}%)YDͱ$*lUTED㋜W5[X;ov2ζ2s6sqDR?$',%g n Ky<?!%QKw/ݻI^bc[0].h,h+-J.)J/kI.I$VȆ8Dq=Q_/*k{#R1ɃS܎Hrnvkd,\z&\'/" * *j 2VB* @(e" AuR9 Sd8)N.p_mâ Lrp_8DOTDAZ$x# 8q. qI!Ñ \p23wM`y nބ7oks ޼ b7. JnM;N˧@Pf*@IAFO-@UdQђ " r9RIvԠ(NJIP)(9,UaeM' mA)P?jAԄ<7:I,E"e@>IQ2XjԸ (A}YV)SҢG5]s ( 7΂KqtAC T1 d*rJJ\P&TkEs*_U~L+TyRox.ET.g{خN8AKCԍe@ AZ֠֩K'ZUg_|L.[t`rxn (/eM4簶dZ(LL6=-n kCZ_ڴgZf{v~= =Ipw\Ӓ=F'}G:^vC_j:Т<>ժr{636ʭG{ʩM]U`tl?>ċG3/+w~zp}#K|$h27~ilg:C|P7kX/k[@k@ȫܫYoҽ;\ξ`j-`{ xC`oya!@\G[w=I8~ؘ>`km@ ڌjZ'*qO}K ' sۭ,}`~ 8]8^7?`a7K"OGypȁ`cifׄ jkLM˂Z+ǂrLdLL><\ʍxd)n.ZLT2PmA/ٜ@$Y;UZxSË,hᅄ|˺<ˁ I|-^,wm@<!_T_/O38ZKn kjUfZN+q ˵ʲ δNN'fG+SmcR&#{wѽ`wr/xBl>%{&F4Us8^S;R_)O!8Phvd;j\]Z\}q\}K\@lpThpoVhpb av7zx:eȵL9uX=pc@skTCXkL47!FJJ %%;%)vb}F"|htb7s;ꮥ=X>P\֞t5$LeiA)=;64) (㜕RҝBvKt# F9< qszv@\N삀s; ꎅ[>g7UyIB*u4mDl}r8H qpMqwMsuLw&ҝ%$4;T{8{q6 ;!Wͧc}h%߹R{JY8=6>=<*dKu8{ydxgY{%fZzg|2=;, nCѨlC?sa\֍l^˲ktg8c}PIJvaR!1*-0IvOp0fdե )}FރTT;]slD޲ra+_W<?!6*&3,@kٯD0w.ConbBoB_|Yn`M絋|ǵct&QF~ַ܉%7gçxP^ ~&1|"LY+M:O`eXd9< ~b'=Yj+Fkӄצ?Y_ikۈoA?ِ/wf9G~#7'qOxZHQgZL[ N~ZDfZTjT򣣉'?Xc/9_qb_~_ #ȓyP ލH$lj .u;g]~ޣ'do<ɯ=#2/ 7/*S^SF#`)!qQQ]@@%{j`b`A:%-ElV,D@<o|>ָk<>gd)*_Gs<Փ>!tCgq ÇAzQ;( ԁD )eN<ʎv 8|݇>dwspW e. 0HNpnC.Che xk@V3@]o`n6L7x [&@5:[A%t8Z% Յ=y6D!B-߹`)o X,ɆJ k> `bv`ge .V@6)ЬL b- ! L8m="T1s7 (Q) H*x(j8-hY!ꃓj&C_ T I8B.!6GD(hi0p-#8-)Y)ȫ>hh肎6hj:Xih(i_/_Rࡍb ^$O3hptrn;mun+nSys?)s3pľP7*& r੥%2R\'|[Mr =o]$ΐIsǞ?{N| @|abB('x}iaZJ0`_dke{/P@YA!' !XVTdo$ZBp<-;0MϧOW1'[B} ^1}gP9oBD=z~9˼|5"E.+ %)Q=Y0W mH#N8ąyMFӾfM0J>,~&d0ue!J|r+Qȫ7B\ <+to@! *+ yf o>n4g-AcF /< J~lN}IXq9q7tv5D#Q2A`ʈ[NT _GJLeNgdDMfTĤ;%7r]ȻZw5B䁼QF=;.0cƾ/ѓ1S1{ȈBhA|Z֧ZoA.ϊXYi)csϳ+ D5bw^]|ҕs-^SK㚦e?=IC޿Dq1/BoɧA3WksSlۑ.mwKlU%5M]y5m-y:t4ϽV&Iuu󲿁x .KNu?5YlQuF'WF茉mNH]SZ[U^ZTXY_][bEu+* O(+]4a}IC K.y>RR!Konv=?cptgehֺƪ⮲ޒⶾU}%J\)Ց[t1Q@H2 ~h[*<_jڨ#Oo;!a<2*|M'+)5!&;?q0o0rt0r@rՕ)e>hHXKRdy'FTmU㺳G⸽$=)v[6f1Vw'd/?=!)+x n%{e{b.莭Wuo -jA4jYwc2nIt3lܱztK窍a#qՃ%iu]Y^v[MT{WTǺ=΋ݬ[#,HYAz$wo[n\.>vJdAW{},=3hm#uѩ8YkVD wF Twvv[5Bkས]kRq%KA0̠CS6~YiQOB qfDvVRvn=\!1jٸky؅:㚐g!_ /ᇪ%й=YˍnmA-Bq>tIltE{< O:6Vf`rRgFfJʮUQ4^{mmβ=K,m]@6o q}F7>…]XvAhe%sE*ɦ/<%( {z"<;xlA€eԓSkr)w9etO\<3m[7:| Ƌ:}OE[۫_Nc+B o>v38^FkIYKk&%&M3Y} LJ }#SHdttT)}Jۏ|33~B6"tbBN 2Bk b<'귒@oMzJq~~[Y;x&=@qwĸ;Bau+suBv"tB[/ &BjU"y #1& Zj D0'#lp@( H6KS0NsXkf[L4!_|f&}+lZP$D&dU_ -5~>MX' eg x5{w^23gO.G\f]w\_|o0( ox@Bt \ i=i|Z ï47D?FIr {g7YWnOi/ @|x DYX:6S({-0/Z45;%?A]!`+]^ۀ7^< |)IЬ#:ޣ׭  %/A,|Ks!DԁfM g~ xO+zXKxNb<1v> {t%~Г;3L Bl(,Ė$0d hI@ d(J'|Oġ}(<~Pnp}em!ۢo0D_c¼}>|tĿYG@8ԅ@0Pd!$) P`%?9mybhNȝ f*:2%bhO5 g΄' ?p2F±W G"=tCDܛ(Pb R[2a1cS"sORNS:RD\z0jk~}i{؏c>'m9v1gh쯰@HGBD]k?9ȿ|TE5UtͦNI:H:S7*kwtS֮1n;{Kܩqw82I䬉:~`$A/ P+0h]Գw WBg#Gs8}i;s2Ɨno_.$a{#C $[1?sJod|OdB)",qaH_ ErFu\ΒmƂ;mul3t*oqlܤMS +&7N.Yd0eSIԋ%=JSu|hKܚ%i!{` B(zeV-]KZ #H_;p>w2$3:+` 7|EZ[EW@Eg-*_5]1>m"m!&" G*exQiT>}'+͖Z,yGx'v_K׶zvhU|Ҕ̂򶬊ƚ5 YC5Yj겎dݩz^^2]NE@2<jixPyR!ﵵgVzi `65GET%v7W/]P4`CIE9/J f[ 'B|~%kUY҈؉{:Y[bz'$V՗eWԕT4455lh.ӜUx{X23eqf@]"$uIs}X)Ƞcd.xxM;BwV!ty#:ߡ:!6>i-~˴s^9ww#ygX,{{T*s+''xKF>mki~֦m9۶dSϤnA)5`㗤хAY #tg#8{}.˪M:.8(,?_~.)X-<ơILK*N?Ԙx #8_c~{)7W"tc=Жh+:-ic%UqI3E5OB_2x12|1{0H+}W7{];y1W9 E>K#܎7οN!27Ç:r5^\DdGa44'5Tn /n?t ,1>k:8B/  >C<4>KL*GOX2?ښ|tA M='nS= _\\nqqviӷoNߦr gGEhBjP\39JɳY]欑fǬᧇO/v.w&+A Vp Z]Xw`B{<+m"T+%`$(,T@_ LpH3B1$A!@ ø>_q|ۏf/!~׿Pw󅃐@AF.8ہk1Xkxh速55P JЭ 9 輎P A_!ĞE<<@PĤ@J@EQ4t@OYULedd0OT^ rD`A;;Ѝw\1BI/bG\R'@B%j↰DR5@\FddAAVTd@ }TLeVF\d4P \8IKΙ: `󮕩*XkILhz`2R]0mNm0uZ`I,wiA :VWؼVۯ`;ʼa@y!,-`-g1*`c V``juz`ٮV`=c:`Clc'WYcaZcq^#b3Np=XqwV Gk w[!؄u1M!ض]دQ}pئ{.8];ЙseZ{e^ ~{59p}):\#!4&p6U2m6¸xΛw`n{%ipWeijA2P쵀L4 l̦ ( PONGF]m]] :N|v6Ei}, H}!{gs/GNRՄ!SWt.Lj2AC΋Pa1~CR/sF晐S!'#B1a=|z t/'m/ (, dB[BŗA $*#4]h":Qh+*MQ(Dcaőj"D&jOXQX'vnGmc%c pC PŊ. ^xTk #O ϤDD,Оޗ0ޛ>cEΌw3:>'MrZ~D$βbxB0I,jYFe7m<; x;mT;Z`ẵ$!?.lMVr@zVjOJafWrevGrSN{䡜9MɇsSn6\9.e26y*f! * KCп7Ks}izѥuGrʁf@AblwvZj[FnvsZi^CZ]~}ZGA]ʂi +_U(O\-~!@[&q8 . QF C =A7 ]ATo>gUutHOY|t[aJJCnfvMVAAefeqyFsIif_IIҢ҂sYϊ gNe|I^Ѕ>AT sM7/Cotuւw3j_YXT]][TSZS_U"#g{EzɊe鹯 sgeO-xyyh \Rm ˇnGԸ\wͪP⊖V]MBbYEJV~IfqFaAeJAUuRAkMBqGVr^q r>d.—,E[zɍn ,BWxJzŻ]xk Z2:"( maMNa}RFFuZQBEneLYY 6&bUq*VEdūȲy%Qxyx+-8{py;f¿uIbdS}ż{ݥ?\(錍nMHKjJɏ^UQ_RVPZW|c9`)fIhÛ93 k8@0:1h6ލ[ElP%2WEDGpb#:2%%! !}E΍nѻ>d&͟S h#+)s0ڴ[gxZB6oʍCX᜵֪4ʌ✠ 9U}YU3WLX}3-pՇdZ$g!T3738wBh~>A]dwZ dn M Ċbl%%S7'Qz)cc9n}e-r׳:nuA8moBdQi65 *GIFه|PIQ=Lfnvd(H,߽}w#gONZL)>Wڀxڀn~E5]U穹j*TrN."A;<"꬏3㌿W TtB 35^g<Ϯ'G<;A&C< yw&ރx[ p;/Qm~TPIT:nMsyI"މ#y"zܭpv^. wg]B= Mxm9iV\D&*{ć dXV_<"kc׮om oh.oY8vgqc?~5{ ڇI<xB=~#e8Ms}L) 4ăO,] \~xLLgXV3F-~ܬc먶ٯZfs5r݁?Pp/P#'qŀ0_H @A DRp};0UMsp2P !TS8z5:Э 딵a\I (.؍wpqj"|T17pkP7mEc0TseUQYT "/Er\Ved`Hz!{ns]AgA(hk ۀJKk:hɪZ62R@oiQHIHXyPXU9[? ק~D\^s{ aрb* (brlAABT%R0KqpC@E@"-L%A[Kp4ГS%еS-hA_UAD4A] Agʃ6y+zG@,ܖ2`I~`~O`#FJ`h X:n*cU5J`A *n0:g> Y03i2f =`{ՐuYД }E0RSW 0p,I5JJlD6+.XVVO>(0c=0e ߱Ik[Xk**2`& `g6`  ]0yXkeXujՀXiFymٞPewEm&U:̩|vO<J K 0S;E)p¯-9p5Q p }emЪӡGwqzi-:?L9rQ=.o?i#iu7 _ڟ`-/.KC|F 2q_?%>!#O{: i p}xHI@a#GGb{b[RR+V/=7XfsSOn|t:p;|wmn[79_{r/s`s6N ?=y+LFUpk*=^c+:I` p?uUJ 2euu=>}DK/D%4b$)F5U1NX5:-- |"|,|$x-p`8>M~)L -IQ A\ i YK Ͷ{"O`볬#tAFa~Fe^FcnF'ms9B- mK%ڦЧAc_)9 Q> ȑYHg"SNײ5ΥZu=MJȦo /al alhalXX\c0YgCCDMWG X~+cg0 dR EP T]ƢǕD/yȥHg8JقFoNgg#YkU@cѷ"{bEM+(!gĥ# Œ\_+e^(sݫZctQp1hwaKF׆XPBr*NV@\Qt_luLOls̊1]qkc;Ķm*%~*%7)q B/?,|!rQ4Q#.A/4W駿$n4?40ړLȋk/oOhHh_1>aob]ڄ IѵIՉs!*Q<|*A^=hDZqo8&;^G\I^W꾲 ғlOOf7d/O.LKJIjNJMLI-OڙZt*$ajiʗҔ%ɳ?4 1ܼCy6~tS XUz{h]Ś*&E( iI`f%T妖.,J,H]537XfvꝬINNvNtԟΏIEkz n]u+.ۼ5 և8wWG8y Eٙiy9cəs2odHO=.9c*O] IgFnB;t_7,6jLwh_PE(.I)HKOM-+m,-P/w%?&mfl؜o9?A8ޅT=s'<Й~.tx _ehȺ>  Pbm#ZZWZ)eFFw+ٝZr17ufxɧԈo Q2׻r|8_D=V#wHmZ]wGZp+la32jҳê յyܐzxB&UZH͗INH?A,Z4c<[8^ g8X/F6X tyk6Wҝ¼WD%uưZ5A-]A-é֋I֗ Aci?ش?AZw=BW=8nC붪-f79I4o$n3*]h6:;ωz {kQvR/FS^EQ{"+~QBíf."t|-Bqm8k\7me+RMln1!n4'b}8>.9./]572F%\d !O o iaieYpm މEJ?,Yqi /z_LX}qҰJҴFմ 0LP7fNdWxjcFq08 I.-omyCyy cW4w%= +B6kBTɨCH^IU* wA|؋w߀b@(p q"^XB6 -j F&:`$ 8J+QZR.) IP$& b+"`ߍ(\ /3g~o" n@[,MUy1eP-qi0 e(&$( eܐ,@A 0S~yBn/c{0=ZHP_XIeBl1-[.ס`LKP%miP4teADl@4,JddAXdk@U{$@~(bK iP&*{aPU sد&AUS4q֖MC9PVwEP*KRA@e@YT@e%~:lLv~h\͇Ni\S hZJ&Ҡ.zrkZeS0%HT\ШFY~^m{%A$_׿'>gF|شؔNb@[QtHQ LTDKLMI |TA?DT@/SKN W~ho7Ι29,)R查J}2 s}X %B`. vF`c $50iY:6+Te^2kѤav'OUB˾}lϓ;lϒmϐlOٝ;wu/P&mQ-@0|^8sKbd'.\iPAfXvgYǩ.G5.M.\ ! Fx0x36gv`'pY~81$gDdcbTϱLN0CcSǃˈ;Hۃ[I=-51}ƐSBx'θ36nBB"B0KpOeqVyw3nq;v<"m{hfwYI@ BGքm[voe5W䁈)~x/\$A~H/sS}9Fd4?`뭱ᮣXu)kY9լAVs`?kE`kM`kmk?uzFng=<>x ܐM/EѣtLl#n2{r}e,FC]+c(v~p7^ic2ZqF ;Gi'ù;-$l^h_ʋT,FTщ*% ;|4̆Ni,ϞXj''95.[S^Q;Q=*82Ve32PqDx\SBwە}M)+؏L): \svt.Cڪܥ^ su-ŸW'ͬL /L,71o%%]i%K R&oO|4?nNjٻ)i%_~_p,A z'=_.УϷ)7nV{kYhiRB'̈ϭ10' |VaByGa|؊u1rcݞ7mF|򯉿HT:\z߁WVkSY ݥ;tuDUyNTИYT[=%/6/=7f 'f4;`VDoRj&F+$ס :ٱAڄ7KՠМٽY_?sAuע )s&&Kl. o >1l@zѴЖ)!-Bg#&D p2I\8KѻP+M<j-1+tNIΈUU2=!x@|phlP[QAބu $!ji`zz>KmZkͮ]*=}GmJapMP[x%!'E-. \\!\&\2d4ɡ %o'Xa(:: -аE j0m]1w@'}4a4>rM{$A,?%~giY搧Ϛ>޺yp^Im|/g0.F_h?z|.d'wtnw]Bav~|x(tQ䵣sg5v;ںm֮֟[?}pK1-/EЌXu$N+@ Sܸ'\Մ'|&{4s?lv"D&c=FΧV8:xꎞwz~% >v wWt XSuSW$) %>N75oi:aTV.˕mR{M+%_o_9.M?p çb~y0!4MTTPᩥ3Gg^σ^*`TUѫn#҆oK%`/Q5;(? QS)~螟eXΟlh[|ѓ4j*mVF7?iҚ?RIW9S&;J䢘Í/no3am@qI%9Q-&3 %bϗ'|(.IxdWT}(q8dMv co>0,@%̿y !jEnBOl2S J\p.+frY^NDp$#Y@E+z1Wa~e̿>~ ӯ@1h(` [09<"**J$DE(`6bvf`V<R4QЕ&J:2DIOȚzp"*MD $ gh+uKxoD#9Db?Hb,"y#B>#&HcPҒ&Z2DUG(Yky")OBT ̓&DVHt8A.Y%bDn(+JOpU!+wO Da}?W4T!j䈪nSxjݭMemW?$nrݲSk?.;KD"rZyCK*GWx}suR~>J}+;֪szy-*;/QRzk.;USzUjg>t'*'܉1;Q: LZ80#J8$DIhI-D[{j_ҾQ}ѳUx^u&w 8a#րƛ_ 7 dº`; ߇&"LcT &b7b.F ?hz00b_` A5V;uXm zcڌ\Yz$Ŋpb6ALG#p<ĕ#FtL ly,uڭ 4{IcwGXlOk1a}Xh,5-»G"VD,wX4iYY΋DYMcb>`tD:LdQ< 'Wtslez*J ݒi..~uL)C3ܗF7ƴ/(fG*ޘm c{.9?[wwxb?/"6!> 6 GJPL+8_I9ZlS.ehFʔ8eIinKr%xW,7 w |};7vkךܧ5Gk"qmM"Nsx?Eb3現uJET5?Bd{B_PY1v2NNJ* T)lO%IZؒ49i4)ioPCҥ?))ī>#n!@qb9VteUiT_]&P*6Xe3)+3ͧ=}%(9<1:!9.+lV@xMԝ3RFT>Q8# ވxHzwP` sĽvTmu3y+y+.8aˮ8dy#3GHhS"fj֘)'b2GO>tJ& I~_'7w.`jC蟻f¦:CZ{e3+af1E^ui™9aӳ ˳Mɬ/lI(ɚP,0kcb~ļo & -DDb/Lu(B؇Q 5QW4rykvVTDOYPQ814/7(wrb~NernNCʤΔ%)9)9Rso$O{=2+"!~~^pi7v6s`ʲkVTwZ[maHqn˓J Jc 'Ԧ''NO(ܛ_x55e|R"2TXcwk:W;;4aqͅ?E<)hB]}eUm >SC3cҦ%'JgfĖɈ)M.[U;5rʕ)c|)#Bq aA'zgU۔>ˉ&ԞjZP\3+90:#2*'!rrJdԈ)U êFCv%θV<:kDx $!{/[M~?.@@땇^#ZB{Ѧ25էwvDƺf$&6F7L/ܰ2*aWdPA_WM{kpkFA-%VW~rYoaю]1sS;CۋÃګgv, vtt\hUF1߅5EZ 0`z0 WC SFlC`F`QpE}^AYb*?>~}#^}=}W z _c555v`:螫X' QKGk%x)׉ 6 [a"o8E0\3?:5s6`>`6mWƌmĒlR 9H)kSǦ֠6$wS렿0m :Nui;pKАjv/xj^n q cbݗn>{E3Ec 8]R_d!zA񒇬%(yirW e̐&mquo[%ͮ]0Lg) D{1n5@s| @9+@PaPmЄkF?HiOxOzv>}&G7lDŽ+cۄq58c٧.] =(4G GGGo1O 9_ftd|Ŕz)5CWcb܇a)8Ig/au̿rP̿RhF#|m"R'*let}bȑ!VI?6DdLeH3JN!c} a}s7wX>0z ?IJLE#<)"%ܘjĀE!V"@\@H<H.H% H ҋ,173kgz/4>EM M!A)7̕@1W l+xFP "6AHiKim)ו",#)B$/HèrQ-l, E,A Q:^BJ??$Ր$rXR-)՗"l+$ DqB1B%&at s !Z$ NBcYpѾqӾp~>qhJEtm%8t4t&|$ILq"Z%bUb JxŸ&>6dɕ:"Sz?W雌O0KN-Cc@0_UAK5EDSH%G+M䣰FDPV|-l sE)p* p(-gV^Ae D^>b>W}|]yNX` '2|b&I ,%2?5H|V/Ԙ)^NF[v+/uGD_n;|F4ls@kE GZ5~Dmğb% BhtŦ8q895p}ˡvӁ GB48a_6)z[go0G}Q:~OTРI`Nv茶.&LUdpDPD`dm"jm#fEt.Xn7?b]w~΍lEۣ)b2 ѷL,&Q}9f̭Y*+%D%f/)p\=ũ;ʩ+ީ3չ#zs{sk9ѻ\fGsm~ѡ)"Vr<!kp; q* aG1}Co$oe"zm%9͍_WW1;٣)ӣ1ng}܈g]6ڸ^5qlz/~d{4У, ˠ¨1lˉnLpOOIRW25`ZJ"epjJw`Y`uA+N]F<~Lp ndt>ҥ UZUJΟQ70².7qfv̉S3r铃K+CB 妯 ',+rxvIr&k<$ (/R9.s}ېu3`e V[0pwMQSPfVSc? ,7ͷ(;;(?0,'<"+6235*#7*-s$*%sgTr慨_i/=Cx"u3;{oU իAc,'^{|sU֬iUSlƻ'L [3#61wvlBmѹgc}# yo<$샓}0{#֠ }JlLlmSYlP^aU2-9wjwFiZ`Rɤ☘QE1C[ŠOG<(QB"Kx$a/t.߂` M67ɚf@Һ0hɕ)ӲB# #+B"C*ET, Tq*$Q`pG RN|< I|` {`e'@%mt(M]ڹ eZ-!F͑6 q.qu>!5A5!5]e|j j>zπj1^Zűs= ZrWjҫzD)S67<=>5-dNw`K \R?o2O9}r"A^a~+0yD FL+DVI/Qj/ 3_k&Xj=k98siN3KMݗn6v[zuO.?}pd6֠F^V4N@Q\$v7|L:hhhhh]mA-M>V[IvѰ;amܗ` b ToDDQ={EwswI; Qrl;Cnw 6[m Y(k;>ɚm'rΡv|p7bЃcvndpa"}ZN8A oxb _1GZIUɣ)TKap nN EPTtRYc~Y>º].C?T(~,8aD $t*Ql}XCf |_:do,n}c݃0m1aKw@1 BCXha)AH2/ı? QM> t XxŨ$6\$PtE2*d 9"oD 1"87. G<@6@)cцcٌpc #f} ʯ ̗VB0y%DEccPZ2N=tB'}5}#c'+( 2#>5 +KA};Ddq"+Hcm<"!F8cTjob̯6n7?H_I{/Vb;!k wO%_RB},Eh ,RDMGԤyDSE5(z`wϲٜ*YoD^+0_*v2_(0+ 0*/gDy ~#*iwT_W¸NW rksD#F XQi3[hKtg'Zլ::m"tEܞyk*MMz{N3b^4x.r a@#G gUSPYxH R;MewFɪ}Q[+hR[#hW[%XRX}`D}`R߫K|~V#}~Dϗ(8b F&]# +CD\H9kO ? p Z&j ( ]&;(Dة; 84OnBp^|c:]D $!GޙH L8{L[c|Gƒ5FOXb8$pQHQ_T!3zB懴w7 Ybڤ#dI{)֐{sB١D@x p J:w:W )tC{Hܲ8Ƣxf"r̻K,WXW[7Y kgª)|uCQ[6uo,fE0Ak#x7u>qPd`c>uuP̢?PӎdL|RƨJ:VYQ k9TGwuб*ceKVӣb6"H)X?w`O$am.e8ϊxLJWZn[rx4l"rU.cT.v-]:%v[iegΥq_K b51X {{dx]_ą-XZl!W̟ؖ-n7KNNJpZ0}JBGYB~„^sx%~vK$nE2Lv-kר 1Ίo?5-erJGQrwArO^r 'y߬a߉[ғO#|2R>OL!.xH(C\CD1 YY%Tw1^CO0X2/|ʤX$׼^s}3K3ҪҚ)¤eĴM~ 3{Rq|&:\mq3p,B ?À^en&9k@,P$̤06//%3';-;?)(0!kZP\V}PLVgPt`PTֆˆ}gt6qϫ^u8{&:::b.&PZjDggVy+TLМ\b?%*krSjqg|Dȼ;B C.R;$Gh>qϟNxkp羽{q }|Ӥ挚zGYe5~j3Ӧ''EMI +.- * ,k ,(P=8Q>EŹoi^΅>sZЪ ƴ9v)%J9 uFQNa3܃rUeU5^3:5؏ G{/CmJ@iss2z% c5vŘuX̝d=knggg"SQFnsov5tmiFe|ۅu߄1stA ¥LY)iK- Nܨ%ҡ5t=%g-hV]Etj9-:GñŸ=o؆_ F;A\ k f!-|5+ho׈HHHHHHHZyCr6+oZ \SrQQ\]s88祘;3gHE'؂Uw!kV'1ǭ^|BIRV[S,IZn7#nutɖ[bF 77XO>V\ub%Zo̭ܲ[?w`>: 8=GpY:0E~0/MNoO_I:ހD wfavf|̶lּ@gp4EBK W!| g|~x ~7F0k{@8ovlKlu̖OD|PH!bx!I >Me6L Ps/=) ;]=2{ rR?"N1@ *ci]G(hr pGaHd-A%PO!0Bbbd9و삟pew|@D0#LTq 8sQ.l"p8t,d6w ~Rx'.|ǻqQ%q"&#&8G" ǐ(q8q J(ߠs`0fŬ-x+<8y' |̖ ).Hs WKba+JhX0E!JiߠRGDM@KyOY@yKYo(el=r܀?O#<;!lB DVGybDNLI%y%nbA/q̏L;Nh%H}kɛGKy<_ }N?w$M'pM,^D.y8KTYD&Z\6ёë(Q3y~))T.|BbRR w幔 (ו(T)WUF)US.\PL9zB=&$CA lQCe1e3>_XshykJ`΢SL[A8~^~V~F~J~`q`qp>!óFw{^4nDX[{!lbL|ЉFyvrG&&[N"LYgRY'sY,&XLgelbjcl!fZ宱&U6;1|'w* ޸)7mtmmXlD؅r8Lr(X&ͱR|,MNNN :Hv,J˒O$9t&K_|&ʨ}E.\A9a.ݕ-@r[Fd2k exL]Q%ңNvGrN!^Crr=w/<+@a{O"7ߓȎId@!_8.T}B6G_5XaA2AXy\y@0S߷AϷUeoJbT}WV}C͗(%D?GO '>>⟄a$sbQߛ{,t"Sd2;R)hQELxیNc|-#9,Xl;i*u:ՉFq)VSblJc Jbƴ8wȍr1+Sf]̘Y 1Gç˙蜘G񺼀Sh@onuQ5=-pJryIbuaB}^|cNd*F.AݒoCrMI ֈxpkp~ѻ6 ed9蚬Gi-i,t{WhL /ig81%%-=%#)#!#>y#6yGtx}!6!p `)> @tOrJTsRGO"?Ւ p$Ǥ <Ϙ)^Q5ޑ^}^a=Cy_x1,؇gpNb aJ\CHpt̮ԀEKN(L.5J+L̏wMs6iWȤ^Z&zrq ȹ*y$A8عl.>}hs ,\܎w 5*P]cD^m*/4-@=%}3I,S*O1=Hݯ-Bǻ-A߳u{k[k[k֕έ5Zh8y0C3Ѵw`l݉^>\~to$I]$ I4!~ -ߖzK  <{Tz\z2ԝz ՜z:48,PYh׳[vUy/}S"9 3 :% !ta&A |X^]}$퇢elRdmreʥ%-C͗] 7YMxH/QIW.FǼa#ĉkBF|ֳc{D/N`_~0~iScƺ/ g09;q >` \%irћT`Poi)'Ax?D|{X{{[Yk ݼ `:fcvpLh_;}gc0TDt^n ^klнbٍ$/Øߋs3Bw*fG o(\#';8?|q9F? q5c#1"5?Y.>沞P^`+<a_ %@˗/o톦_4iF: c@78܄h_: @\BQ1(p 8gC@ !PLߘ4bf+fu0ekx kr)% i1B1p X {&!kH)γs0o6޹=B^a%lهxU;y D9|Q"$Дq z8k'!ǐ@YPYYӊcX[p#n H 6pE؄ei0BDS@%0 faN3f6,p~+p γi)QB9!?[D"BL,-BD~2?|hrèĒ(p[ s+q*o\u%B_%VY pFj7:'dnpPeE ?eWEc㩒| B,R:\P·s*epZNRN5QQwSkSj.\C٫Ge5v?i[?7imXhA6F7P(%)PhЮiS/'DЎ%dN124MnAfx1}JF&L.0֘ReDPx {}(Dw8l6] v9x0(Fy_PbPUjjm;{g7OOOil ޯ1|Rc<样4G z)A} 0.9[(۷_ƅz\VS#μQ~{"##4wkτio /^3ޤ3ޡ9_w,|Lw$|Zo8|Ao(|Y0~}_gtpF{ ']lM溍ml9HGMXRvąOLD 7 FÂrMZAAр˸OɸW0i-i%8du#EOM7~7n0FAk^BsBG 6.C2 iw:4Ɂj#u RMrL{cͺc+ͻb,:c-:b,b7[l=`{ƺ!u}=_-jc30YOyE$̑\]˵vٜ鯲)-L?9ư[d֙aўg!Ԧ%Ʀ)Ŷ1ۮ>aخ6az]M⺪;ǡ tB܃9ց^FeR@|wAz{^^svi]Ъ*=}]EZcYZsqjKQjkAj[^y#O |?#Lc֭X/ACsuvlT*tTxv6DW%Xeg9edlJJ͜J<%|+1uϤoݒ2: 3>ఆ/0Bކg6t-Vm3Z;7*?P(ò8"ẜ <Լ2/anwRnOBw|ތw\ޒWLEW=v%6q D7Q] Dۡ'p5&kֆFz`HX$44-+;;xKP2Ur#{Dn%_DQ#5|qxylO _"`G:4hC955^-*EMڹ Fu ,"j UnaU\ê;Vw ~1KuO}WZm||7 nVc鶗rmWUhn3kZ 3# aMUV~HCp}P>swo|`X77>4(4޷ IS. Y 9޲A¾p$Ӱ 렮JVK)s}f]L|lػWc/^A \LJ1(wAOM y| (oܔ%ҶK%m Q I N37^o3b=o=Ukx9r|:3k{>od і=@e(e.%mN/|:P>h:\o[Mϩ\M Mf >uשIUש*.Sg^RrRq⁊8갅Q[s{N0'w"vuU@hE% _4EkV3w[k!HmO˞$=Y = {9߳ cy6;Y=ed-w0rkxw0C!U!=*QrY"Nl^uGGc$JZ-ZZ)ar$ms0\DgN0]&hvU!J<4'Y2M&=\ A,1s1/FҸOjgHRxB g 3 Kݏ,z& 8Y"p`./YB?Snɓ-eNR$yˇ"s+$nKt#ay יp|uT܃{Y"D/ɿLy  " 1`JL}vy ?-p1m Q5Dnټ~jNH ɠ @1 T?h،w;8]q߇ϋ{0΁ 7B>۾Jd&H܏1j?DԓIɃ(†h%07{$pgwl_e DQ?Wwc="bVϤTI0CzP:PZۺR @o;Bo@gu0[v{ohGAv?=އ4`!lXaClH끦_g\ F9_eHF^9AP ʰAkBaC~*nuci<;qS ]FA|H|OOqO0\%FBWDa9lp`(b"pUjM@Jc}I3؍k.!]Mzޡw񓢮*X##-8<͒b$e$I .2 ț;EG!KS9x0%Z17bZczg>\(x: _@[ xQ$IF [Mè*sE}?yV9oX_V%nmD7"1Hw%%Vz3K9 t{nJ9ޫtM3zFwzJ ]PbXO$)F8Kamu&CzG6^OsE2RKϫ6 NzNtEsEOi-%tA:2N:ǰ` bݷ$ќE?ҧZ9J/Mxz(&)zE f]f3棬S[Y'gY--YG-.[f}8 g%c/oIK51tґuڏmyd3r$NڗpWq9G899K99wqrg׹oKPjƑMg?WXV? 4#;jegY PɣqRxKny}ռ&nv]=<&wxJo'3qBfNx|)ܘ;#7UBI0n=-)o5:k>,/7RvoNL935 Ӿ S [}&|G)nۣ8wDiҰKC*(+#װ݂Kt 3fs%;0<22T9Bu,Nu$Uu8Km(hHm0hB?hN/hI'Fw-AjvĨjm>b9~'%砻r&5n ѧ1vw- aiCaZaZ}aZa a]a}ڝac:a3:mat7m ~cO auPFk ?ybB[:]OEȥ=I:#Jbk os⦘Ph^ANWT^gT~Gd~[dAkdAKdaS&ƨ)=Fnj#WEmRG>E ^@ueaزƢ4 J`mNKmJK RJnkM1l2j)407i77[3n^Ӽ,EIeˢ- 5/yhZF3Fk:sQqAP ,yر-Kdp/CvcZJ[rVSR~}bqMBie|yE|eY|Ui|Uq|uaMAM^AۜYeeeVЕRhNQ؋|y7|;\7l?ڴ(ʔ8dbaUaRM~R]nRú줍YII3iIR9$' Lb]r$ Xço`Zq; 쩄C uyAj1FIii6YiSKRk)|a ?)uzz!6]\*cXǥ0V"|UrC=x'ʿqcKZQaj)sK=e+TJ ô 9y 9)6)IYE*V~I'AւSTi~DmLjO"2dlZ0/!Ua>X3Y¦^ZZjLڞSU.]O"D#,J?$4Hh_./_Q/p +Zp>unXJw1}3=F h%yg#F5RU-UG>6H5&B;*(~}ytEMDy޺ &uAm+NZT[66iZߦCm6'N/%asF|@WА`^jRkTWnXhPc_̯~o cF>zfYyV3kxEԏ1 > 5GzL(Ǟ&%Ԟbߞc^f`mݾE߫}g mimM۵qiftpsV@݌|zƠ;u$cp؊0ĉɋ  SQjz dkyjykti lVsߥ\ŹsGJTU.Fm 17b> xLL@V|8ɦ$jL[mY!.IDDxxxx"|NY-dm!m诲6#0#(pEt ?]>[!Dbu<5gޔ<ױ]%}0)X޺4\vZf]jnk9;˵]>'aC _I)Fj D4<; @C@"Q>"DK<[ %c^%%/t)m6Zb. YzK,Ӥ}iBC{fi,s>]|v벨r9Ƃ7&3x-2ZCQ~װ;5/ADQ=}+`F#D=pD4@0Y'n H9ؠ La#E~]R_GxZӉ؄ )\wMЛtz (ƗOp?7Iq7<[(HW&xK%loix051q\܉,O/1M0w&~Ct:9ܳ\}4ax2l6#%zfFf^&_ |WOxC 8:Y*-tst^NXQ#\UFb~zҫ0zQ"nq2:k;)>$3Ldv:+S :.UEKj 150_X}FKޗTץy>PL5sV ծ: tRgc7FGN:蟢h`%2iȰ9`v6aIKѻz^7Үͣ[:t.{Y0:i@YG-Y-X-kX,XY{zXVX{YwvZ/欏g/[eO[*1e;gҚLX3q` pZ-TstΕ}>PbA A(Xɯk9f~gǙrSܭ] q%GH  0 c ˿/k5`gEZv3%7E7o.0Y8iޔ{o}=o½ţUzGǠǸ&Y!2e=nz/Fr6n|=>:49+MiĬ6@I(-rcr#|K|+|}z}{z|G|7.*vWlm})50+haEcp|&tgP[ PWrhwdo u#;0(T PW ,U VlVi ܨ!pH%pR)pZcQ굁i~^`*5|녭8 tEl'z056CF[cLYcPl_DbWxJgXZ[hzkhFKhFShfChf}hVmhVMfYuC/ꔅ- B8vqhKw=s(_J9ш8qnҝ1~Q Zui:5:U%#*""K"F #g #G3̍x('3Ü?#=@P7.D} [adYڔO)Bg^k|c|Jm\feLNyP4:Ӡ8(ܨ 8/$7z$;z43z4=YYc)0U"zQb.B_>T[& )Ц |TOٚ劤0DNa|A^|qN\iV\YF\yzԸ~IKaĸq7,>fqI|,c _]y$p/Dɵ-Kmՠ f{Nm ?ŒHX $5)<92):!:>:6iuL.kA1먤#>L"21JdL8D9t;ޏ ݰmC 5QmW< pDӄtъϫyT^E_ɮr祯SVƗEj J KMB͂K;KFLJf}K\5.yO߫'¿1.<}: DxDel*hTFclc5H&5x* jjbՙ~Uņ>U>z^ճՇ=hWV]*r1n#O;Ћu 2`3Vϊ`OfQr%%%b<"7˅* Z5[2<li?EԎG1DX{F/ D2@N3z8cA3,Ltttttxm8=2ض7ut$YZ㌄#91ygakNI `H3DgdCfIw1Hk14ImT:Iia3)Y gIz]I?8 s8g/b#J#CC+-HnYd Izٚ]Hrُ8Q^N$A^Z?dlwzoC7Qθ(XE0l器g=TUw X sO L0 >v܏r>4{Q~q<D|~ZCJA69ؠ ,ܫpFpCAwo\47kw3-7:BB'^ $WmЄ f |SN?#?Q @}4N E.c^vރ"wVWJ{=nF͐:l0 p%§,p< ذzH-6\{D,^G,^%X"sQ q76(x-CWp"p2Lp4ѫԆiEw1&/1Xl9oL'LL谹#Ep.xּu*k:ݺ5cͦ5ešȚ`ml=j=l{{m~88= _3 ,p `Yuz`˚wtgow p9t~g_Wr MNmAi봇,dkRN_KmpgVвm@HC/pn7Marw⌻JJ H y>|^{)۽tn1/qHl]zո3b3 31J&1?{&?~@H.xNv,6BV f:& > >c >j|(VU\sG2ߕJ}RoFd#oE< ʟ#Р³c2XFC h0F'EjcL[`|k@) Q! M. G6X:J*Ie}FMeTKR+pO=/WF5*"| ]t hx݅c(X;"2a !*C!je!%!!u!!y!Z9!{Bkg<NZZi&!.Jk=|?^1ǥ8M7cscܥ~ Q!ʥQjE)Zy9:U:-ὺi[Rw%/'_OI/!NB h>rq hBu$RИ$]xrű1j1$tA^ _?YPa 4& FqYah3FQ D1zDe@Q~LÖaصv)R}UYS$=eJYji QZzqq9Fq1qu&a&q.Ľ |o $eDxp#{TlE:x!ٲTC,N^tVBjZ0%B3>9V/F(4fGM„56Ip80y( ~ }D1Dg}e`Z`[U$hPQ)wJK TWdEDd$fdgfTdl04˜6Prڿ >$R7hBLJX_BeQfJ)u&xJ+D 4 t }+[ t< i{(Vk7.5s5NP3raLaK=l)B\2(Z5P S&Y+Z>Rů"^ݻ"Mӳ"_ӣb{E[ŀkŔK~ N*˾Qv,}P¨3j"\G .@?9K|e(k`O>䚰KqMlLQͶ&gNpcOCgC[}k}s}S}"__Uޱ~Cyu}-k[M5`](pr,@>m Wl)Oќ:YޝnN_I׎sG #Yơ#Gƾ\f]G]G϶}Rʺ}U9e\ _s[2kfM_=Ӌ\=w zK`wC*:d@.Crd9 z pl#փ \L` |Al[d`m<6?2KO npE8':Ӈq4=\؊y 8@%a`7!EVjd1a@fVd:'I/2 fLD'RHwt0&:Hc|wʖS)}NʣIya) qJlbY9 NWY1B:oA*` D{ 2my,84Y"DRp=A`qa&z(0zs.z879s>U+@ԃ1ng 8p"e"gM{7љQO%yWM^w zB{y?X>=]\ׁ/W `[d?=&JdNPJjue|ȇc!P~I}4䟰3 D=SX Q)MZ}"՗0"7W>?΢|z.d+w?^#_B'D ;>'E>7Op/'<%ȶJԃ<\M'x:X+UbxeK[ W"] 䃧?@¢0B_SSWbr",n= x=L'X1,LG8Yt[HKr/YM$iQi7ovJӼGeNЌU&&m&Ҹ"-)X򰜼.qrIRN˘1>R*W5.W/9 ڡQK5iZiV1ԚqڬLcZOӈkI+t:be՜ml/8aKc+E}k!m}ڧgK i0v h(i8&iq%m6Q 4bML7ѐ$ ~kzz>cugw1v3FT-2p[#s.1Ӥ9K r־q0֘M,k&&5d)eVzm=.~F-Yv v$ZnK4}i`pWQgH~e#>s[s@^Th1mv\{H %^~ [{ݝ9]>!RmVDf4^[WVɫuovt^U}Lqgeߗ+pI.1 +=0ʍ xU`Lj/|Ϝij VzgVxɕ{ɕzʗxo//Wީ}T1bJ?+{1kPʝ b2b;a@uS{ 9N>U:Gf}@\|BbRRrrJJj!djB7ԒSM{0*I@2Oeb?dvE(SS!EX+Ý$B=BsU2UӃ҂SՓ;55g4⃗4c/jF |Ȉ&›BhG 2c'^MiSRe4ځ[(pFeF)GŪ Ò5ò5Êjc۴·iG?vhWCPF^ 3:[ 6G4ьUN"'E*#K6%&@1):L%^#HDeDEF*u~V ^@YKQjG1Z+"g пe9b^ģvORqQN ;#ʼn"NLSM Q$DGkƧW7%L&,j$JxQ3 MϸZqG, A> OPr R:x 7"& (EK Wr(+KҲ,YəL7^L\dZRXjZpJf@J_JOJwJWjgꄦGꂆ{iu\S?WsI,d4Vh m5<qs)L )ܚVƗ*/) ,Vt+*g+9*94(KK;얳/9%]g20 ux>F.hÉNAѽ8{MXQY$Q#&Q'&PR# R-%&'6 =C$|^a2 %۠Y$ 8kS%ȐIM5qgHbڇXL#٧h0SC6 Dкa xLGI %'j \ vAC!\_P-(}^cY@/4!0Ȼw`a#Ν ÆY07=@\;@dD~H aU:;(Bg/[ c(ˡP`O(ԾŦ]&w7iEQ 0_E>G{H|WϽ mཱུ˪H|U}7#ȑG(v0X93Zg/W57_k +Y?Qr4_ %=HuCAw(ߠ~;"ssaԯQ~@9*G5H GϦ~GSE܋ GP`o>XOh | Npځև¯xeׯ5vaG,E,ނX""(z ?ďd NK'xRCP18*QG;30&/""p"͋FbdX9{$.m`{Bt)NozOׄae[lE0G!-q^) I4#Ki\M҄| mHc 40N sIqQmSzTn5"2=>4Rk-g-a?,I{hPwi _ڪJZ1YKHc4GKhHu_t{Gwugh^=Ez7hԪ353,DcX_#X\?~,KY]20qu4fA&4dIgB=YeZ@M˨Ӭ͚ͬZ6Q5a5g՛_c՚˪6]eXҜ4l]KAoῨ M;`ۤZѐ8zl|XmBX6Vm"km6d[n]Ϯgٶkvv;%({Sj&;n#n-#y WCٱ 2϶"&#RIݎfhwhH49N-?SOT ~ -p$f% I9=%/^/^&e:! 8=0aӖ^6mtS6w#jra׻9sjܼnAnReqR%RŮYBB^z^[tFlaL 2indS^MvJNPVʈȾ oFa`gJP1;VojѣKzGNd+T:K &+U*U+.5(/RHާuV1E/c<B@v:oJTcvt@Ԧ 3VI:o^_L_\o|PA蛩WWתׯ7,[P;w[%30ar_? #Yow;`Q.IeaTnLya6P>7=ă',"W PjR Q W ޭ|R- y5OTPdTx!2A֟MʼgΜ933y6)K풧LH>}B W6oi>f|:q淭› f m4ڇ6V7 26 F2.mإ]m%Mr$;BIצt:s,::c:;ZEv-ju"VCHcηAl5Z0Z#6u p.yj1 5[ԼgH ${Kr$(qژL]T>hЇ7kfϾY;QOߛwZ^3nl/al"X-ZY=3J'-.O‡$t8^BS\Mp^;ܦ +^ + 6:tQ\oy'iAw`81n ض wZxI^!\+'rw^ ^+"cEⲢZV4YbX&._'vͲb~\X.D}zQn3=? ۻD(Q:e~QmN&m(7ݦ!֛jSXn,zmA!3jbSKN\XwWIEbWϫw{x/c~>,G{D w X!3 qGaDuY8"w14}:oE6$; #PL$W(()y  F6@u[!r<'o4x`yHR ME<ψL<+?>H#F ^ .bqA&Prz!7 7!g!gh:8X{({()#"m=YUnC&'% Jd2&(^{Ww>6 V3X巊d\v|-~^wA_QDՉ<IxBݛC<',znrQck!"oLy (~7&3~@"/N׀=tn:pcY,.Y=123H{I;?]1OV }O@Co+u [0IC녽5ENW7p̯e |q|7<_A};0/Mw{ZQ4x"QHg|/P~72="T6'd78'a^;Ϗ*SzK9cr7= nhG*F;c1 괖fvdGgD/σ;zZ \-3 3:8y3]`10K@X :yV6c`u/]F^J]_xcv?1`L~c9)`㆕4fPb7sQx=Dh{dv~.[(I=5V=EWݑ5&F/fW~ִ+Pa:M gʝqz\G/RSͲwPғhq TA<6*GGuPs@ԭfo.s>o>o> [\)UNuj3_(7WN'hchً졶G ;;FE=Cj_D6+%3MIXԃ3vPz0zB`g;8l-h$Ox[i?E.K^ yS=LɷYk2L2 JWdDz;Yjc%3|3=”wmݘlur\(eM춝";sdۄ2Z6Ml ZdNY+keBY9y,IM#K&ɷ"LJdrD; ?{L/2?4wSo!a6&N'O*e{uϗeңF{42ijK{ΖEC2Tx^;eQ(KCNcTfy5=țaL3S ;6|-d Q<`, Ȗ"YX!Áu2$en` ʜE2;hM|H||=oFmkQkp싅L҉ɆEV8Po xe~x27=Q?٧f}aiO0˓^½`WCq> BQh- ]dji* bueyVy6yvyy'duOț;!-ل-ROHο>)a7>O3NH5NH1Nx0z Y8Q5M =_TaZA[*BҲhmai!$2$&.>xڄ)%K&$,O,dPz.mlC61D6'"}T01z& p/tY-pi"u(5RT(5x]fuEZUUJUMRUmbU]|U]\%61՛lZGU_~25˰ϬB+~ -7"vgP7 )2Х*jFi0%1V;1YԐiP`Pa`noѸ2qEXChCHWuS?3h_g5ZG#'P#kyf ޯB6:HJ$IBkךiME#ZaV}Hl}P"]`zm@~yoT[ޫhl2Z\淂u5#""4A˰Qc+1=.+=(A=9OƯE3KVz)={}9qyt,.]K֩ݨzi0._BV8 DŢpol1W/]g0Bs0]< mR\y[j8KN휻źPl^2*7 s kРP5"SB$}YKq,#0(F"eH؍dHXԋHFD7L41w@(sr e؇'|edH/Ty^:':3bJtkEK54^4_ÀHiJ2xRojMsʶ=|Iڼ7Q @iѱ('rj2xQ`5 \CF1塌_}^OANz} MCw)/{REjp0cճX0}@ź6̸u57%?D ;3DZ=U _C toq0f׍[H|lu|/s`CײQ s(aTwC_Gs0+k=≄ VM`t;z/ʰ| t7Z&Oރ }&&`/S3@%t-<+ BO)u.^?÷߆羉o_= |EvE9M4UY>GC㸿*Ud0}V4uIvTHaߏ;̣,> ^? \AFG|+d _31`+v:`^ԥ]o?}qz\lcL\0'.7bhݳ _`ɴgIR)%rSO]ѿaxe>er=' yroBGhæQʷvLK '%P ԩPAM{q =W'MvNjt짴vӆ7ѴFUK?b /lT N8Si#{賻c,6^لf:dC i32nkNKOa>%YM,a?7(Q$}2+0_fJW`t6H{ i PZFkiK5ojj6j:UKeb>ppg61-mB-d I|',L┎-<[^i/LL iLFDnVEUDޢ+|DW$sh( 7}@E6 pȁrsX6@Fz'IgIKLiINjct1 V}e,}y|}Y CIVCqaCaMqYƾ27'hm| eBsL{yVB1vHDWiJp.1V[0EW/O7%J,- - -Z&mN:ht*#?"JK:-U|=|A4KiLu4N Q*R))i”bܔjiVY֙sS[mNIo=%uR}։i/[%~jMb&qQp77VP˗\ڨ=stR5I*=,;P)Ίdr33,33 3+S3ld$gͶIZd:>{u\9{_**{ M46_AnNQ_.#1NHZ 줸U $ T*f'S3,[&Y%[ϰ+赎)Xh]*pedY{, `-"4{\5bs?6 ;gҪy(y\ y}6ijѵJr˜$[˂%,J\K,KǕZĖZFZFXFͲ/+_c-ߣ)?. ,.#wFK"ս`\j7G:gCjBa>ޛUnNRk'ɔZwI p%6N]օjk!]P.nֿn֯ƷnwuŻCg:*޳h3`4lAV|z{Ec t.M6,QM>"aMҔ5ej 5MU&OS=}5}ѴSܛiϋK<ըu7Lwduz.h th3rtK#x vICOvwopTrqhqǎб]&{ȃm3bWoZ웍*궀HPCР]ˠEV8w1>C>lm E>+q,.}(}З(2žXjŦoXŢ,âu(=D3mt.ڮEi[? ->ܜqȒ5"^t@,>>{وՐX ya(XtC1JeAo= |  wI.Ri7쀖Ey>sTt*B)|{,.g_N<<,g\FG^Π'Z奻Dz1n|w!: ÂnMuޜ (>Rb/:#8#Tal0~ tq&J{/xc;rute(?硌[QsCO~Qx9o$m:`^{9+wxeb=(<1nPԜu_hO3Od1?t+kEU)3?Hln ?) W0/a2|nc1N iQ韦=(o[P$yW,6(! ?3z'TJF(( W`]ށ 4`/{c<:|'p?X1`Bӝ4.o/߀_| le݋?@Oyᰏ|ڨ瀎8~>DV8X`SFuԥzt˧I÷> |{/-3+W%ӧet hݱs0h$łFu=%ZcLvrn:B/g-nُ2t]r>M7ޓrQs`]y{t9 xr$QJ8E`T@-߉g1kA0SI@`ޗ㭯^Zy #)D.i~n`RhRjo9 8߇ |bBM6N16zL7<3wB\l f(V8yԧTN 8=YR0cAi jtm_LntaeH<%/ u^xZ"fNu ``5W,k%&Zg/=]JbL7QTH 2`zdyb7c6q JYԩ2SV(3d% 4eH3$4KeP^_{BJѽ&3 Jea4+`>T{_ ӐzHB] V7YVeE,V):[ eM ʀ4m>mVwJqipN|TZ&!͓)~D2}Q3> foc( gYd,*eprqLَi+=N2ӹRùY]:ե_f K*MFdCRԹ&?IQA3o{"\{Szl6ˀdsNdiʔV|U*5(ӼۤW I "վT/徯(e*?jJ}R)} ymWs@0ՍD[)2^:ܥ?@Z"dz@L HlX$uJm`RԢTT**KMJIMQyMA5yhsuFݵLo-ջhCBM+xo=У=ZCeZL &,I P*4a%ҰMIx(S[1G1͋X͉ܧˊ<ˌK.-#}Zp>-̨:Up-!Н ,=zczAF9HmTEJytR)NFgi uyѕ]vL>3OPVG?%!).Cb  1Z$-RQσ=:tZI4&k*^ܤ$O BhMv|6+>]OO(3&R[ ɉ II I I qI7b4D'=gJ!*eTBj Qmp5PFmQ=JS0IR%;%HHԤkSRRt)9ĔbCBjE\tԙ1i-V"v"Onׇ=I>$E\j`\j&ܞaC ^.K@ZUm,,$fjⳒuYYBCTV!2e˙Yٮ 9 ̹ yZ_zL/hqB}h9e363e~-|-HJ$HBHLaU(ІB +tN]`Ѡֿh֯hƷƧ6ūwWgFGp'v j> YUbviFJ$ė[ItD{JxyVDHpEXTi*4S5>wYL*nĵⲸT<%sWsQTb^?G و,C2 t􍞪 X*u[*>1U?E<ŽDĥUgcbq,Ȅ[Ů־#5 FeBQiޏtb?~ ߀,RšOW==K8vn).! М. žZl[źeX5/o> D;aN{]t!`[(,Xdž*EF!sER蒀mF&vۊmXw{UwXtG{sD@MGb]Hr'| igI.wT.O4 yg1v@(B;a3A QLjLa20p94tieR/,יA~r9e&Fq=jZ*|O"4PmQ;0Ɏ0َ "8"y^nC@ g`bF9K}7AՍ%[|}-qD/ DLb#kkd2ٮIAPЩDk0j9e5~M(^c`܍/@W#զ%RS$I@`ĕ ʎ1!܎ ȶ$6 AfCnd+QfMҍDSP6y(H/ϧ)ARphL9(#6!C6<'0=L x=ɢpc-N,>q%:~әCT"H "wʙQ9;H0|@<~z#qA sM8M"dq#g3iw2ߍ k4yC@Q>6AQ'w? W$ /U@f҅k1XAVߋ Ǖ/]*ӕ>}(gr@mU2pn'd\>JFʟA]Բ(.AnM1/NSh}8n_]yuԵ=9#{RJ8y_5H3(!kDq=G`ɇ[{(m'qC7hWC~x`%F>e_C-hgOXRp"BS:ZrDoKm0?LC!x)(2jd zlF豁vY//ckNZlVUOUO[[L/0?ƴwe zpD,e8R7o0C)dSN9^B;k8KL!\JVsPQi>F^g`?0v9C)?;\J/8RilTH]Z V7XsY*Efb.ng mcje*}4Dq&)w/Vⵖ9LwJ /R* 2I~MIBzu2S$]v0Ja&i/MxUi|^ZMyʯ]PHdjWC2[Mm-d[yKu̴.$Mv\i/U=v9UdS4;JitΔw)ZZqm*Nt#n#RNJHi)tS ܟ|IQQd^K^󸋿79 񄠄}#m([b#!R-A)١JfhI+֤hR§kwk"i"Vh#i"ic".k"FF JnEjދ||'^*^[UmQ%і 9Q/iQJJdI&Fh+q1ؘN]t.*v62v6<6,6$68mp̿u1F}HQxdWE to/ 2%G%>>RKH$i򴑉庈ĩvmhmHmpfm`M@-5ok|&܅og\${q%j- (>o΢8&!`Iw(͜6GB!"9`/OrMu[Gl=mL GG/t[߮p@hL+W0,gY಼ټȷlh> dz1uuH ? <ԭgi>׳+G/"eT6k{ͮBP6D[lƉ6cM|aI*z7E;әxYd V#nwTZLwƨ|t?Ɂb͉G}=nƮظPy(H3ː4$=<_ 69;ټ7,A|㜺IRs]9o!Fy+s6 ">x'ф_砌ߗ3&2+r F\A;>$(6wJフ)u \ɷ2v#U~$=gȻ0w`JohބM :,5%usgi1ż9s'b֞P=< */Cgix nw1#bM;@I E=QF} o5ur>`E3\0ʰ]-7Q~%wSveÔDn]3 [̫X|7č3AO`瀨p۪s0^=V(X,|/,E7yq=†O3>`rܔ`瀪p>EF&RzFF3(cv; R02n3gyv'Yӭƛ&7怨)VFݝM `bu(˩eDm=6ÎՕ O'UToYNoYF/Ss0ϣ]YrYplK\>aāgSB0Zj Z>灳VYCݎFi x *CL52zCzNn(:ENrpjez 1_Yge6%R,<7SUns`(dʽ;2LQ#y VX`S\Q$s~?f_z-Uv,F{̠EU&zv#< ?WJoTS/y~PdBzBdm2W| +$V.X`UUV3:"ix5eVITj> Q\%U=Ny4Μp窹VzL7K.LfbY, 2͐' %2բZ,ƲMzjTX2Rb}\m.I5)yKm@~B3]TQs@62Km-Ql=.P">NHՄ,X ʥtROj")<_'$d9^ k6%bFyJ@(|<?$ ܆.kkq !(aY7m쪑zG;vtJ'_)w R()vNB4)pɑ<ul&r AIw_&[dIE=7IQIp3*QK` q S*Z4=:VR(E a+^ɒ)]))>!Is$wmXCC@cԨrz<2:B݇P#(KDs ?I HIOD4IS˔z%6UD(JhE%8!%(u%(sMPQh FPxܠ7 =ZУ_-P$=FRB$)SB$6$LbBb%:tD+aJXxޫG,T#+߈;⟊OO0b~uvԏksѣ=+cfbIHlSr 8g?JAFDy]DJѕ%g".9>,Q␛$r>Dls&]"ov.hrDm_E1d&?<|\z&jdty6t^=v)VShpǫLbkX .H,Ͷ"ӝO$Qt3L/SE nZg!1KXGYQ]`Cى6-Ch4 \{F`wem43 2f2wtt÷E] ]8N׉ҝsiTn; R AAB[4(<k{q8Z8cy/N&`?qY2}.x '&9t9OD?{/F~U9|4e#cGMQmc2^/D$ snc2^-33/&Z&l12|"Ps|O?E;s*x=WB' o>E=auc=zM1puZ0 y^ w&(ix{nb5J  NgȘhc؍fM٣.cr`o(o{R{1OiH2򚕚{2>nf |-ǰqpNO3choENˑ48%br~>#Vƭh{sro\)7Mrb#A-mCҁ `DS7e9(O)ba:=t.uo]4qnTue>/¹J1gSH]O)z̤ٔ=R2jނ+拏+!ӥڴd<#99 s:;Q=ur/ZDL}$E_I7;Iz7X0^J .pwzZ5C]Qs099`F 砿zF%&Z.0ƹ,hξ}gkhY׭{LG/?0 9OBc;|{+|{ vlw#zGujW5QOYJ7`m5ch*vGF[G!Jr0dQ(pI.9`*dz,G豘v~0oG2H0G5~l4zLyL`c >ga^?`4P#_E I'"By1K3(h&V颤NJm­&ukӍܪ~=;E8v$CLmL=5b6tn`Qz uJN#b*[yoLRӰb#-:ZF=f䚗@3v^0,akH< +X+jk1O\%XG%D Ẍ[D,RǬ`[jIw',[F8p`AC+bKg A`EG V>JR#eJh:X3 %(;/$Sdh? c&k1MQS m40Z/ z{ӻJG* Rn)Rl"ER`U(yVk i/6#fARlKyIOl_xۏy1=B|&˜)v$,LބM9HI}L11M'ICLq3$qr$8.8uOI};}*QO.y_$kz ګнU+Nv,N^(S%9V]HKĹKkĸ5K[D/p5G=J=x|,?HQ_d1zxy1=Hk/J=$M=|%#X=$3Q"2$ܻ@¼+%ԧI}%w?]{Z}#{ǨFσ}Pk?! 󝼋c=MI؄ɹaĘz(?gP `8 O<,F RT'n h8+!<t)6%}ބ_604060Ne0`2o*^}z2`Bj &UDءӹ޻|&g~}*RC("]hZtA:.|;AG;hs%'N?'чA)^ k %zl$޳|l5OB8Bdgm?C9惟ht~91Hxz&#jftP K0-}J'}:a#UcX_*+*Jc]Gdz w1Wr:}'s 5 nOm! NN6N>|Nvu݌_niOy(1)2Sӝy=@Eφ 9D9Dd> ((mr\]ǩw#@A~*sQs̜2)E !z;d,Ά__\T$)#%e:elqXu? RfRd G!Yz=gWACLWGџOkOʚ<.\b.'u>J{ksB_ϼBp:6}]:{8{c DMz˷;Qaf90RQ|Hw"6w`YoI^2 "=]S<;OzIH4!" PC =z]: 6Q\ؽboQzl>sr5f̚>P[^ϙ`h硨[r/31?"jC!K+M{^ѽDP>8}d,x=s`u`>=Sq4wo#^5",(9piƓq 9N" 8r<*;{U<Q[j4\{?a_0A!`~;TRLuiOC~0^>ك;ivzv\ 5ChjA?F`G$[Qw[ܯuw2.eQpƼ 9N37'ej-shԝh#^IGs5сPOz/<cBr *zf;0CtzjL͎? ]lC M,x!!9te|9o]=REMtEҞf%-hK(%>=>S *zFFҢJh3T iEU{B:^^kכj|d&}2 ۘ crE19F/éy(+d)L;nr#`LQrPXa4n^"%ڀ<+sĞָQ- ]1JM)m^]2a_$-6at6T,UbX!Y~aH6;NIctڕ |xC n](;hĴh=Q4w/;Nцˑn:jb%:D7 _$D3hW DWmJz˧7s 9x{6>K~K'1|2lU[!Ҡ wi>vRjӘ/EҶ8ږ,6ڦض<ieMr˥0i0Q2JjIu%)G%$9|"?Kß:8~_oӶ_,ȩH+IGWi&m}%)Drsd;J ,i'$ڸ$DvĹ]4u{I"?J[<<JR2T =,A! %jO$-g#:3iG}N2X&yO\x5 f"n-q|iYcpqH"vI&2D1/,!Sf`jpbOBJ :,%~KE'M4qOq?i*Ω┖$i>@l:M:c:4\:c>$iORޡ2޼Hڽj<׉],YrDtNr9ط8o6ec<z6FS<#a&ynA6ƅ ͯ~7/<7@Cڒ~)4m9:NnbW@0/0kFi / 55|?D>,!ܝ{@}]}Z&Ię`0w RB )!%qbFSa1ؿ؞̠8;zh[n'0L /Fx Fw5KG JJ 0n8v7U` LU@WCY; )~$U M:4E_ g-aP-8}1޾P_ׇ/a ,#[220CM|`:xy _Axd F/nc!R\Y] g`n2LM6$ -|~C/w٦]H[:3|.NkHt<KTd.UA 19#x]T* cp41J-2 {qVm]B[3{#OB\qӔXi{UfF1c6:f&a3itu^`} 9~/q95 i)d}`V$_U_Kl(NN"R%dȥun1^8/ l5 k:2PuR(u"-uX+ft_;3g3V6 z & _ߚB2?>]LiM;؇b],nMN# q0I,{9aABt44ݜ2_.%u5Ȝ3&\<Ĵr<Mr _}ZϊÝF32>jICoTwJ'!u ]y!j $@?/b DpDI+`o`$L2 pI{L7 "2ʺx Dwy#b<EŸF|)dj6nMEYs]3q4))wW[`( |$65E7mK:{ӎ9:G-citσO~O`BaNnAQs1y{} 3m/PH%'0vۉzKD+hO%t'QL\YMHtJzfvT0E"]r\9'ԟE`uwn̄f &H0_m_jR/mysu`(9 ~O3 c-XZ[ [\"\c!HuQͧsl-Fg4x5漙10mb#X [%Ml<< |}Tcs;Acr>ni/2޴kQpyw2ppWyT# B oF >FqrtG> jĿ)ۢ6Gk,7^5v󂴔()Ĭ(н`5 v! 9QNI85W3x%3iOK)Sk>ɇ"]hee%ұtl"HveJU1v o5%cgx.7Mq}J\|.I#OZ,X^ir 聍`#yH}OZ,A'~#>I%^#AC%x8 |PNQo19N;yl8r!eV'4R8Kߤ8ThWx{HSq Ma`^"N=!B"ƋM$%-d- MK*:tk ^?d,EW$#K )j`7m$zsT8EECt3Nۘ\A1TC bIPcH_rUk;HyWe8gúhKJY%߉o|IrU"%iL>iH2`2 d9):]5ͻ c3Z^/=dӴ^=щCM#`fIjtdmR8e1Z"C5 -lAڞՔ*_ۓ+4mJ՞;w%`ʍӶy[[%PPT+Z"xK p܊|%`"adLYȐu]vgs6E ൪d,ґG=~$"^XGd"Gv(G[--c. i@! mI|~mCYT3H͠}*,EȘEơM\ LdhBaLt?:Nt^G;RAG@zGU@\ `=[;dh{C桬dYǀHhS{Rh n&^ALQIot[IAe袌ZFMĘz0NvTJ*'tC硨=aq)pu602~_CuQ=7RV!E+ś`pA8@:n M`ЏQX,rM]wkBb*g]yOF0<6u8l mA1n=6_Fe%11}ȇQ6&^U\Eڹ8EȒA2<>FWf2~FLLESFP1fdUdU?f'jt@5ugݴ 7BxL9u7 ڵ8/VFXm,P μ],m>Sq'9;ټ^vyO Z)K}kr~YGZ]l67L6]M\nA r~y*}6N} ?Dt]#Vg\!# ˠ?$t&Au2Wpҋ 8pyח0s(,Bj~/ )ڳHF& _"K~2 g"i`Ix9NiNuO0cP=; QPנ5Zb~ydO?8N 9AGM{1 ~^ct'nh;8sO6"zj^kן2èP˪2C!tq7s/e7}\9!ſDl\9/@+epYb^&.h홬/'f~zŇ%LdPP{,N2GL ?̾JG)2Em-f7#s0xceF<CFWZޓ^!m C Ycc}޼F}0^4qprӐO/+>Ԝ ڐe,s rBc81NH DKjrܴ9נ1gv1vBV3m N{6_кH4ddҎL B~$X}қOL3C&c1|4K>իH#TN?pzCzR54Iƚ`4m~ WmMʄW UNrx WaV6xpO$'"j/j2AڢF!G )_ؖ;mLCH+#mA/gݙDLA\C]Iw6 %,3m _8bt޵D;̝^H9K A6$fêcP״ݭy()q2H$@YycIrtfvc#QAi!vj,!YP ߱8 o*t+ki4v:./_ v'lBY(`Iv` Z{JKKSi ލ2ijq4q-W}87'Nsc{;Geq\lݮ/n[m? Ba--a/EM+& ;~v,/3N\Rٻ8nb;@l.?r?f?3__g"޿~o/R@j^3i_EHKtEg `@GqsG_q L :3NM[0yd0Q9%v0N/oS{@Z8dNPUWtUNZ!Kzik؇kp01#* E@"IVIQC/oZR ߊ,))Z\m<"\h8m?' L?rA'OJGt]t?JbbP(=E)TX,ڠ j+dHm 0I)P]y?\4Y18-ԉR;'T *谮t`WաTޅ3idfTn'"ٷ#Lm~}9g8&V O'~E?5'@Rŀґ}hHo&N${N6[z4e-k<>Zy:pd FO5()CqJ*%VgkF""~O]wCD Y<҇R3y l}qé-sEӜ?c1>#<OLiICu?C8˘z>y5 u uUecgҨ{O/o?Ȧ1SR22i_ЦmQ⒎:wڭGϲ^}0pPŐ*G=f&N2uڌf9w -YlU׮[a-[ߵc={}=<#񓧞x|_~7}]v?ݫU-vRMvѾ:P5;L;ǩ',Vi~;(JA?J Q(*hbRtQXicXQ)d٩TOJ9j9rB))4R J7P+J;o*~>T P*VGu?US5bjw;r^1X[nj,tfT[YWTטNa[[; ]Ph.LGA(D*A'(EidJZtd Jr%<߀AC5j¤g9o+V]q˶v޻!Ey˱Gi}:h2 e4VLICi_b_Cs?˯4kׯߠ7\ Wp5\ /_翠Kj߿v7?|v_nn%_sǹ~&\*WQ̯¢"o?xmFY͟s[7p5\mM~c S]/}CC??^w|sȫ>Fu5?t5:öZ}Z'[϶J00&Z!u$tyA{֛Q-#{v4m]ޛ W|ן|B6Q%*6oc_lY'xfyI?Z%_YVnfD$H"_oes-B0.X+Mt7I[_Y36~5'W-/8v-[%P Neq?wcU9/4d[ũqfzWWdZkϔ&l EPn!u\Ċ_\jZy#Ѻ~HЫ.!#X\ Za}^GPCx9=ѮdC0棻 4ݵqI_]=o|?ͫjouvqYexFWף&9w+/i-_BsxC*FNxݎCZ}yخeSfs5k5te/c\נ @~9$= 0Xbx~0@gz"\GQGWw_buhm^7]d@tI3l$x@P'@u#`&DG`%:J=AM`7j#0*9{^>w?~njGkľ3Vo{tޭy멪[8W?15G_biPz#Hߤz] ȃ@6$0d YFz`AGKH=GEUd9{aR[zu<`p儙WlqHpO^{ s*ds{̧y:ZZCw=A\">MoՏ[ /1 :f ($0QoHl$l ڶ=8Œ``%z}6IOӲKOLGPNG0GOb%(=Ay3bs N2׍k?]~Lo]>6?q\~lSXiO e۟ P>G$`s- zX[m ڂଁ@,Hpb Κ` jI@@Xc H$xYN=A` QGnSAfMOP[Ga $Ug.XfC>.+7'zvDݸL;2vI%A{bYmܒHZj$gAlKB%0/;%6>GNnؒ&gu14\Z{VO@knla/꟪llԀcib2Xy``Nve~}Z f p,' "E}̒^#SFiCb! 8^NPhSJH;5!,`"+61id(~,@*DF.g=.B 2z n&+J%s_Bgw>eYYb )-~;* -z}FRMi &2,075T؄%~pHN@88=@b!ϻ. Q)`Z F!J))p"a?Kk)# 2]@ٝxmd}hpE&n T&̰r :yIJLtсo¿ ݸ6/c?7QE֠Zlb8ΘypOK,}rAJX$a<3J xFIhf1bʍlN ξؔq™HV|Ti!>{|o 6xS|_d^+c^e~_.1 *I/s)'o0C7Y?pЧJ#S cA ^F -OӟnTB9Ɯ:zb0k!@f+ PO2JئtIY@v5o.2^}y`EEnրߛJOHK=<*> yZh)I'6b H!I8LD,x$Gܱ% r t! pf!GRHR9z>[Pvqc!(ܟ_Yw Tow;;n&GZ#lm;;f%>('Cpբ(@Wh?SD Qi}w7 ΢C #}SyF}_ ppNvVfU s[d9kɤq:"--}CdLM8/n4dЩ 'K(ωQ{ej (.}b,P ㍷Ё> țz+SZMUs?\_pY{r Y늳c"n\: 0pq~=17+&kAcYkXMx00֛`=bI$o%[1#c6g$[tL~abﷳ>p_.cdWPTJauܣw_Qh^9#(/:{~zB;GmYpQUR_it -z3M|Ąjzr{쬪bds\ 诳LY.N2GFgW4o't} A:Ϟ(Hٛym˖;Yζ>pD6Э؂`A@B}\8yF-L`X4a _SB}CEV_e_`gy~]%t\I+l/p A~j^<{tM}S}kҳMk}Vzڰ%:-DQz"JS=PЯ){ZSLa^z+:94? ?h^ cwWs`A1Gj˹kJqW A䪧XÇ ˫.5VU?]}];[rWLW@=gokțKڣLv0M؀S6['e 8nK+!Re+^{^8"H/H~a~rR̼S=Nv\?߼#yC`dy93}^Eg9A5}+_$;2 endstream endobj 16 0 obj <>stream ,Photoshop 3.08BIM,,ehttp://ns.adobe.com/xap/1.0/ image/jpeg Print 2015-06-03T14:12:58+01:00 2015-06-03T13:12:59Z 2015-06-03T14:12:58+01:00 Adobe Illustrator CS6 (Macintosh) 256 168 JPEG /9j/4AAQSkZJRgABAgEBLAEsAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABABLAAAAAEA AQEsAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgAqAEAAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A9U4q7FXYq7FXYq7FXYq7 FXYq7FXYq8884/nNoGiSPaaco1TUEPFwjcYEPflIAeRHgv3jMTLqgNhu9P2Z7MZs4Esn7uH2n4fr eT65+bHnjVmYG/aygbpBZj0QP9mKyfe2Yc885dXstL7PaTD/AAcR75b/AGcvsYpcXVzcymW5meeU 9ZJGLt97VOVO4hjjEVEADydBc3Fu/OCV4X/mjYqfvGKZwjIURbJdG/M7zvpTr6OqSzxL1huj66Ee Hx1Yf7EjLI5px5F1Wp7C0mYbwAPfH0/d+l6r5P8Azv0bVHS01uNdLvGoFnqTbOfdjvH/ALLb/KzM x6sHaWzx3aXsrlxDiwnxI938X7fh8npgIYAg1B3BHQjMx5Mh2KuxV2KuxV2KuxV2KuxV2KuxV2Ku xV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV4l+b35nTy3E/lzRZjHbxEx6jdxmjO/RoUI6KOjeJ26dd dqc9+kcnv/ZvsECIz5R6jvEd3n7+7u58+XIcxHtWaeXvyt1vUrP9J6lNFomjgcjeXp4Eqe6IeNR/ rFQe2WwwkizsHRa3t/Din4eMHLl/mx3+Z/tTI6R+S2ngpc6xf6nOooxtk4R1/wAnkg/4mclw4h1J 937XFGp7Vybxx48Y/pGz9/6HLpH5KXxCw6xqGnStQL9YQOlffjGf+JUx4cR6kfjyU6jtbHzx45jy O/3/AKENq/5R6tFZnUfL95B5h04b+paEeqPH92C9aeCsT7YJYDVj1DybdN7R4jPw88ZYZ/0uXz/W GBsrKxVgVZTQg7EEZS9CDb038q/zSm0eaLRNZlMmkyMEt7hjU2xOwBJ/3X/xHMnBn4djyeU9oOwB nBy4hWQcx/O/499730EEAg1B3BGbN83dirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsV dirsVdirsVYx+ZHmR/L/AJRvb6FuN3IBb2jdxLLtyHuq1b6Mo1GThi7bsPQjU6qMD9I3PuH6+T5c JJJJNSdyTmqfXnpPl3QtG8o6DB5u8zQi6vroctE0dqDkeolkBr2oenwin7RAGRCIiOKXwDyut1eX W5jptOeGEf7yf6B+N/cw7zN5t13zJem61S4MgBPpW61EUY8EToPn1OUzmZGy7zQ9nYdLDhxiu89T 7yk2Rc52Kphouvaxol2LvSruS1nHUofhYDs6n4WHswwxkQbDjarSYs8eHJESH45dzPZYtN/Mmwnu LW3jsfOtnH6k0MfwxX0a7FgP9+D3++n2b9sn9b7/ANrzsZZOy5iMiZ6WRoE84H9X49/NHR0dkdSr qSGUihBGxBBzHeqBBFh9A/kn5vk1fQn0m7kL3ul8VjZurW7bJ/wFOPypmx0mSxwno+a+1PZow5hl iPRk/wB11+fP5vSMy3lnYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYqwj81 PN3+HNNs5H0231KG6lZHiud1UqtVIWje+YupycIGwPveg9n+zvzWSQE5YzEfwvP9J/NbT7zVLO0k 8raZElzPHE8gRaqHcKW+x2rmKMwv6Y/J6XUez84Y5SGfITGJPPuHvT38xvzITRfMkmlTaDZ6glvH GYZrkAtxkUMQKqaCu2WZ81Sqgadd2J2Ic+nGQZZwMibEfJisn5wW5X935V0pW8WjDD7gq5T439GP ydwPZuXXPl+an/yt7/v2NI/5EY+N/Rj8mf8Aoc/2/N/pnf8AK3v+/Y0j/kRj439GPyX/AEOf7fm/ 0zh+bwrv5Y0inf8AcY+N/Rj8kf6HP9vzf6ZPvL/50+WoLpXvPLkVg/T63ZLGWAbY/CVjanjRvoy3 HqIg/SPg67Wey+olGoZjPylf6z9z0zSV8leYbY6lp9vZX0crEyS+jGX5nciQMvINv+1vmXEY57gA vKag6vTS8OZnAjpxH7N6r3JnaaRpNnIZbOygtpSOJeGJEYqSDSqgbbZZGERyDh5NTlyCpSlIeZJR eSaXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq8+/PDSJL7yS1xEpZ9OnS 4anX0yDG33cwT8sxdXG433PS+ympGPV8J/jiR8ef6HzsrMrBlJVlNQRsQRmtfTiLeu6rpsH5oaFa arpcsaeatPhEGoWLsE9VRUgrXYVYkqem9Cdsy5DxRY+oPF6fOeyc0seQH8vM3GXd+OvusMFk/Lnz 1G5RtEuiV2JWMsPoK1BzH8KXcfk9CO2tGRfix+a3/lXvnj/qx3n/ACKbHw5dx+Sf5Z0n+qw+bv8A lXvnj/qx3n/IpsfDl3H5L/LOk/1WHzd/yr3zx/1Y7z/kU2Phy7j8l/lnSf6rD5pPqGlanps3o6ha TWcx3Ec8bRsR4gMBXIkEc3Nw6jHlFwkJDyNph5T82ar5Z1aO/sHPGoFzbE0SaMHdGH6j2yUJmJsO N2j2fj1eMwmPceoPf+Ob6k0TWLLWdKttTsm5W10gdK9QejKfdWBBzbQmJCw+RarTTwZJY5/VEo3J uO7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FVO5t4Lm3ltrhBJBMjRyxtu GRhRgfmMBFiiyhMwkJRNEbh80/mJ+Xl/5V1FnjVptGnY/VLrrxr/ALrkPZh/w33ganNhMD5Pq3Yv bMNZCjtlHMfpHl9zE7a6urWdbi1meCdDVJYmKOp9mUgjKnc5McZjhkAR3FPB+YXngAD9OXm3/FrH J+JLvPzdf/I2k/1KHyb/AOVheeP+r5ef8jWx8SXefmv8jaT/AFKHyd/ysLzx/wBXy8/5Gtj4ku8/ Nf5G0n+pQ+S6P8xvPSNyXW7on/KfkPuaox8WXefmg9i6M/5KPyZd5V8/f4pZfKvnNUvLe+Pp2eoc VSaGc7R7qANzsCBWvWoOXQy8fpm6XtDsf8p/hOkuMobyj0I6/j5UXnuv6PcaNrV5pdway2krRlug YD7LD/WWhzHlGjRel0epjnxRyR5SFvXP+cfdblkttS0WRqpAVurYE9A/wyAe1Qp+nMzRz5h4v2x0 oEoZR19J/R+l6/me8Q7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FUPeajp 9kFN5dQ2wevAzSLHyp1pyIr1yMpgczTbiwTyfREyruFoC71nyleW0ltd39hPbyjjJDJNCysD2ILZ A5MZFEhycel1MJCUYTEh1ALznzT+THk/1BPY6wmjGarRwXDpJEw/4rLsj03/AJmzFyaaA5Gve9R2 f7T6qqnjOWusQQfjQI+5jX/KnrL/AKmzTP8Ag1/5rynwR/Oj83a/6JJ/6hl+X7Hf8qesv+ps0z/g 1/5rx8Efzo/Nf9Ek/wDUMvy/Y7/lT1l/1Nmmf8Gv/NePgj+dH5r/AKJJ/wCoZfl+x3/KnrL/AKmz TP8Ag1/5rx8Efzo/Nf8ARJP/AFDL8v2I3RfyfiXVrOS38zafcTRSpKsMTBnb0zzIUBiei4Y6eztK LRqvaQ+HISw5IgirPLfbuTXz/wDl7p+veabvUl8w6fZNIESS3ldeavEgjPL4hv8ADk82MSmTxR+b h9j9sz0+mjj8HJKr3A23N9yY/lZ5Bj8v65dX0Wt2mpo9s0Dw2zAlS0iMGajN/IRlmmx8MrsHbo4v tB2udThjA454/Vdy9x/W9PzNeRdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsV dirFfzK8o/4n8szWsIH1+3P1ixJ2rIoIKE+DqSPnQ9so1GLjjtzdx2H2l+U1AkfoltL3d/wfMEkb xu0cilJEJV0YUII2IIPfNU+tggixyZ7oPmLR/MWhQ+U/NM/1ZrY/7hdaO/oGlBFL0/d9uvTwoDl0 ZiQ4ZfAvO6vRZdNmOp044uL64fzvMef46sb8zeTte8uXPpajbkQsf3N5H8cEo7FHG2/gd/bK5wMe btND2lh1UbxnfqD9Q94/ASTIue7FUw0XQdY1u7FppVpJdTnqEHwqD3dj8Kj3Y4YxJNBxtVq8WCPF kkIj8cu96L6ujfljp00UMseoed7qPg7p8UVmjDpv3777n2HXI2xec/u/H48+Y4cvaswSDDSRPxn+ Ps9/Llsssk0ryysXlkYs7salmY1JJPcnMZ6+MQBQ5B9D/kt5Vk0bywb65TheasVmKnYrCo/dA/Pk W+nNlpMdRvvfMfajtAZ9RwRPpx7fHr+r4PQcynmnYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXY q7FXYq7FXYq7FXYq7FXlP5rflVJqkkmu6DGDfkFr2yXb1qf7sT/izxH7Xz64Wo09+qL2Xs97QjEB hzH0fwy7vI+X3e7lwx0eN2R1KOhKsrChBGxBBzAfQQQRYZL5d/MTzHodv9SSRL7Szs2nXq+tDTwU HdR7A09sshlMdunc6rW9i4NRLjIMMn86OxTtfNf5VX7CTVPKktpN+0bCYhD8k5QKPuyYnjPOPycA 9n9o49secSH9OP6akqjzJ+TVo3q2flm8upB9lbqUhK/L1ZR94wmeIcgSw/I9qz2lmhEf0R/x0ILV /wA29bnszp+h20Hl/TiKelZKFkoev7wBafNVByMs55D0jyb9N7O4Yy480pZp98uXy/XbB2ZnYu5L MxJZiakk9STlL0AFbB6X+Vf5X3GsXMOtaxCU0eMh4In2NywO23++x3PfoO+ZODBxGz9LyvtB2/HB E4sR/enmf5v7fue/AACg2AzZvmzsVdirsVdirsVdirsVdirsVdirsVdirsVWTTQwQvNPIsUMal5J HIVVVRUlidgBhAtXj/mj/nJ3ydply9to9pPrUkZo06sLe3J/yHYO7b9+FPCubDH2bOQsmnGnqojl ulGm/wDOWOlSXAXUvLs9rAftSW9ylww/2DxwD/hssl2WekmMdWOoeveUvOvlrzbp/wBe0K8W5jWg mi3WWJj+zJGfiX27HtXNflwyxmpByYzEhYTzKmTBfzJ/NzRvIU9jDqNlc3TX6yPGbf06KIioPLmy /wA2ZWn0sst0eTVkzCHNJ/JX/OQPlvzZ5ms/L9npt5b3N76npyzelwHpRPKa8XY7iOnTLM2gljiZ EjZjDURkaD1LMFvdirsVdirEvOP5ZeW/M/KeeM2mo02voKBj4eovR/p398oy6eM9+Rd12Z29n0mw PFD+af0d33eTyPXPyR85ae7NYpHqluD8LwsEkp4tHIV+5S2YU9NMeb2uk9qtLkHrvHLz5fMfppiV z5V8z2r8LjSbyJv8qCQA/I8aHKDEjmHc4+0NPMXHJA/5wUk8va+7BU026Zj0UQSEn7lwUWZ1mEbm cf8ATBkOj/lL571MqRpzWcTdZbwiED5oayf8LlscEz0dZqfaLR4v4+I/0d/t5fa9Q8o/khoWlSJd axINVu1oVhK8bdT/AKhqZP8AZbe2ZePSAby3eS7R9qs2YcOIeHHv/i/Z8Pm9KACgACgGwA6AZmPK EuxV2KvL/wA1fzt/wDrVppn6G/SX1q2Fz6v1n0ONZGTjx9KWv2K1rmdpdH4sSbpozZuDol/5d/8A OQf+MvNdroH6A+ofWVlb6z9b9bj6UbSfY9COteNPtZLUaDw4cXFfw/axxajjNU9gzXuS7FXYq7FX Yq7FXYq7FXYq7FXzz/zlB56vI57TydZyGO3eJbvUyp+3yYiGI+y8OZHeq+Gbfs3AN5n4OHqslel4 LpOkanq+oQ6dpltJeX1weMNvEOTMQKn6ABUnsM2kpiIs8nDjEk0E38y/l7508sxJNrmkz2cEhCrO eLxcj0UyRl0DexNchjzwn9JtlLFKPMNeQtZ81aV5osp/K/qPqzyCOK2QFlnDHeORNuSHvXp1qKVx zwhKJ4uS4pSB9L7j0+W8lsLaW9hFtePEjXNurCRY5CoLoHFOXFtq5zEgL25O2D54/wCcsv8AjpeX P+MN1/xKPNv2Xyk4Ws6MF/5x/wD/ACbug/8AR3/1BTZla/8AuT8PvadP9YfZGc67N2KuxV2KuxV2 KuxV2KuxV2KuxV2KuxV8v/8AOVf/ACmmk/8AbNH/ACflzd9mfQfe4Or5hj3/ADjt/wCTX0v/AIxX X/UO+Xdof3R+DDS/W+wc552LsVdirsVdirsVdirsVdirsVfKX/OTul3Vt+YUV86n6vf2cTQyU25R Eo618RsfpGb7s2QOOu4uv1Y9Vsa/Jrzvp/k7ztDqeox87CeJ7S5lC83iWQqfVUdfhKCtN+Ncu1eE 5IUObXgyCMt32HJHonmHRWRvR1LSNQioaESRSxv4EbH5jOe9UJdxDs9iGNfl9+U3lbyQ1zNpyNPf XLPW9no0iQlqrClNgoFKnqx3PYC7Pqp5efJhjxRjyTzzjrk2g+VtV1mGJZpdPtpLhInJCsY1qASN 8qww4piPeylKgS+QvzN/NHUfP1xYTXtlDZGwSREELM3L1SpNeXhxzoNNphiBo3brc2bjrZJvJHmy 58peaLLzBbQJcz2Xq8IJCQjerC8JqV32ElctzYhkiYnqwxz4ZW+ovyY/NfUvP/6Y+u2MNl+jfq3p +izNy9f1a15eHpDNHrNKMVUbt2GHNx3szzX/ADBo/l/Sp9V1e5W1sbcVklbuTsFUDdmPYDMXHjMz Q5t0pACy+fPNP/OU+sSzyQ+WdMhtrUEhLq9rLMw7MI0ZUQ+xLZtsXZg/iLhz1fcGP2n/ADkz+ZcM wkmNldRjrFJAVU/TGyN+OWns7Ee9h+bl5PR9L/5yZ0e+8tahcSWi2XmKzgMsFlM5a3uCpAIjkAU1 78SK+BOYkuziJDe4lvjqQR5sU/6Gu8yf9WOz/wCRkuX/AMlx7y1/nPJ9CeWNWk1jy1pOryxrFLqN lb3bxLUqrTxLIVFd6AtmoyR4ZEdxcuJsAvLvzZ/PPV/JHmldGtNMt7uJraO49WV3VquzAii7fs5n aXRDJDiJac2fgNUl/kf/AJyVi1O+vv8AEttbaVp9nZvcrLEzvJJKskaLCiH7TMJCaDw8K5PN2dwg cO5JY49SDz2Y15m/5ym8wXFw8flzToLG0BISa7BmnYdm4qVjT5fF88ux9mRH1G2uWrPQJPY/85N/ mRBOHuBZXcX7UUkBTb2MbIQcsl2djPexGrl5Pafy0/PHy350kXT5EOl64RVbKVgyS0FW9CTblQCp UgH55rdTopY9+cXKxZxP3vSMw258v/8AOVf/ACmmk/8AbNH/ACflzd9mfQfe4Or5hj3/ADjt/wCT X0v/AIxXX/UO+Xdof3R+DDS/W+wc552LFvPv5k+WPJNitxq8xa5mB+q2ENGnlp3CkgBR3ZiB9O2X 4NPLIdmGTIIjd4Nrn/OUvnK5mcaPYWenW1fgMge4mp7sSif8Jm1h2ZAcyS4ctWegS61/5yZ/MuGY PK1lcoOsUlvRT9MbI345M9nYvNH5uXk9N8hf85KeX9auYtP8w240W8kosd2H52jsezMQGir/AJVR 4sMwc/Z0oi47j7W/HqRLY7PZgQRUdM1zkqV1dW1pbS3VzIsNtAjSTTOQqoiCrMxPQADCASaCvnnz r/zlHefW5LXyjZRC1QlRqN4rM0lP2o4QUCDw5k18Bm3w9mirmXCnqv5rGLP/AJyZ/MqCdZJzZXUQ +1DJBxBHzjZGBy49nYj3sBq5eT2j8sfzy8vedJV02eP9F67xqto7co5qCrGGSi1I68CK06VoTmu1 Oilj35xcrFnE/em/5qflzZ+evLbWDMsOpWxM2mXTdElpQq9ATwfo1PY9sr0uoOKV9OrLLjExT411 vRNU0PVLjS9Ut2tb61bhNC/UHsQehUjcEbEZ0UJiQscnVyiYmizX8qvzi1ryPdrbS8r7y9K1biwJ 3jqd5ICdlbuV6N38RjarSRyi+Um7DnMduj618ueZNG8x6TDq2j3K3VnONmX7StTdHXqrrXcHNBkx ygaPN2MZAiws83aG+veWNU0VJhbvqFtJbrMV5BDItORUEVp88OKfBIS7kSjYIfIn5p/lZceQLjT4 ZtQTUDqCSOrJGYuHpFRQ1Z61550Gm1Iyg7VTrc2HgrdJPIflOTzd5rsfL0Vyto976tLhlLhfSheb 7IK1r6dOuWZ8vhwMu5hjhxSp9S/k9+U1z+X/AOl/X1JNQ/Sf1fjwiMXD6v6ta1Z68vV/DNHq9UMt bVTsMOHgvd4N+e/5hXXmjzfcWEMp/QujyPb2sSn4XlQ8ZZj4lmFF/wAn5nNrosAhC/4i4moycUq6 BinkvyN5h846sNN0WAO6jncXEhKwwpWnKR6GnsACT2GX5s0cYuTXjxmZoPX1/wCcTL02vJ/MsYuq bxC0Yx8vD1PWDU9+Ga/+VBf0/a5P5PzeUefPy58zeSdQW11iFTDNU2t7CS0EwXrxYgEMK7qwB+jM /BqI5BYcfJiMObF8uan3V+XX/kvvLH/bJsf+oZM5jUf3kv6x+92+P6R7nzh/zk7/AOTJj/7Z8H/E 5M3HZv8Ad/FwtX9XweTxRSzSpFEjSSyMEjjQFmZmNAABuSTmeS4wD2jyx/zi55m1GyS61vUotGeV eSWqxG6mWvaQB4kU+wY5rcnaUQaiLcqOkJG5pLfPX/OOnmry3p8up6fcprdjbqXuPSjMVwiDcv6R L8lHfixPtTJ4O0ITNHYonpSBY3eVW9xPbTx3FvI0M8LCSKVCVZXU1VlI3BBzPIvZxgafaf5Reej5 z8l2upTkfpK3Y2upACg9eMA8wB2dGVvmads5vV4PDnXTo7XFk4o28T/5yr/5TTSf+2aP+T8ubLsz 6D73F1fMMe/5x2/8mvpf/GK6/wCod8u7Q/uj8GGl+t9V+bPMdn5a8t6hrt4OUFhEZOANC7mixoD4 u7BR880WLGZyER1c+UuEW+HvM3mTVvMmt3Ws6rKZby6bk38qKNlRB2VRsBnTY8YhHhHJ1U5mRsvT fy5/5x01nzJp0Or61dnSdOuFElrCqepcSxncPQlVjVhupNSfClDmFqO0IwNRFlyMemJFlmWp/wDO KOjNat+i9cuYroAlPrUaSRk9gfT9Nh89/lmPHtQ3uGw6QdC8F82eUtc8qa1Lo+swejdRAMrKeUck bfZkjb9pWp/A0ObTFljkjcXDnAxNF79/zjX+ZF1qdrN5R1SYy3NjH62mTOas1upCtCSf99kgr/km nRc1XaOnETxjrzc3TZbFFPf+cmNVu7H8thDbsVXUb6G1uCDQ+nwkmI28WhAOVdnRBye4MtTKoPlf R9OfU9WstNSVIXvZ47dZpTxjQyuE5OeyitTm8nLhBPc6+MbNPZ/Mv/OLOt2WmNc6HqyardxrV7KS L6uz06+k/qSLX2anzzXY+04k1IU5UtJtsVX8jvyQ1CfUIPNHmWGWyt7KUSadYPyimkmiaolkGzIi MNh1Y/5P2hrdaAOGO9pwYDdl9J5pnNYZ+ZX5XaD5600R3Y+rapApFjqSCrx134uNuaE/sn6KHMnT 6mWI7cu5ryYhMbvkTzl5K1/yhrD6XrMHpyirQTrUxTR12eJ6Co/EdDQ5v8OaOQXF1uTGYmim35X/ AJk6p5H1+O7iZpdKnITUrGvwyR1+2oOwkTqp+jochqdOMsa69GWHKYHyfaVje219ZW97ayCW1uo0 mglHRo5FDKw+YOc3IEGi7QF87/8AOWX/AB0vLn/GG6/4lHm37L5ScLWdGC/84/8A/k3dB/6O/wDq CmzK1/8Acn4fe06f6w+ufMF8+n6BqV+mz2lrPOppXeKNnG30ZoMcbkB5uyJfAhJJJJqTuSetc6p0 z6//AOcefL1rpX5a2N0iAXerNJd3Um1T8ZSIV8BGo28Sc5/X5DLIR3O008agHpeYTcwj86PL9rrX 5a63HOoMljbvf20h6pJaqZKj/WQMv05k6PIY5B57NWaNwL4rzpHVPur8uv8AyX3lj/tk2P8A1DJn Maj+8l/WP3u3x/SPc+cP+cnf/Jkx/wDbPg/4nJm47N/u/i4Wr+r4O/5xn8v2up+f5L65QSLpFq1x ADuBO7LGhIPgrMR70x7RyGOOh1XSxuV9z6wzQuwcQCKHpir4l/N7y9beX/zG1vTbRBHaLMs9vGoo qpcRrNwUeCepxHyzpdJkM8YJdXnjUy9Q/wCcTtQYXPmLTi1UdLa4RN9ipkRyPnyXMLtSO0S5GkPM JT/zlX/ymmk/9s0f8n5cn2Z9B97HV8wx7/nHb/ya+l/8Yrr/AKh3y7tD+6PwYaX63rv/ADlJfzQe Q7K1j2S81CMTGvVY4pH40/1qH6M1/ZkbyE+Tkao+l8twyenKknFX4MG4OKqaGtGHcHN4XXgvTl/5 yR/M9VCrcWgUCgAtkAAGYX8n4vNyPzUvJv8A6GS/ND/lptf+kZMf5Oxea/mpeTFfO35j+ZPOjWj6 4YJJLIOIJIolibjJSqsR1Hw7eGX4dPHHfD1a8mUz5o38mdSm0/8AM/y9NESPVuhbOB3W4Uwmv/B1 yOsjeKSdOamH1b+ZvkpPOXk690UMI7puM1jK3RJ4jVK+zbqfY5odNm8OYk7HJDijT4q1jRtU0bUp 9N1S2e0vrZuM0EgowPY+4I3BGxG4zpITEhY5OqlEg0Wc+RPz287eVfStpJ/0tpKUH1K7YllQdopt 3TbYA1Ufy5jZ9FCe/It2PUSjz3D6Y/L78zvLPnixaXS5TFewgG706agmj7cqA0dK9GH00O2aXPpp Yjvyc7HkExso+fvza8oeS4WS/uPrOplaxaXbkNMa9C/aNfdvorhwaWeTly71yZYx5o/8vvPOmedP LcGs2Q9J2/d3loW5NBOv2oyaCvWqmm4IyGfCccuEpxzEhYUPzN8n6T5p8n39lfqiyQwyT2d21AYJ o1LK/Lsu1G8Vw6bKYTBC5ICQovh/OmdQ+zfyHuZrj8ptAkmbk6pPGCf5YrqWNB9CqBnO64Vll+Oj tMBuAeX/APOWX/HS8uf8Ybr/AIlHmb2Xyk0azowX/nH/AP8AJu6D/wBHf/UFNmVr/wC5Pw+9p0/1 h9ea1YfpHRr/AE+oH1y3lt6mtP3qFO3zzn4SqQPc7MvgOaGWGZ4ZVKSxsUkRtirKaEH5HOrBt0xF PrH/AJxx82Weq+QodHMo/SOis8UsRPxmF3MkUgH8vxcPozQ9oYjHJfQuy087j7nq+YDe8+/PXzXZ 6D+XepxSSAXmrRPYWcP7T+sOMpp4JEzGvyHfMvRYjLIO4btOeVRL41zonVvur8uv/JfeWP8Atk2P /UMmcxqP7yX9Y/e7fH9I9z5w/wCcnf8AyZMf/bPg/wCJyZuOzf7v4uFq/q+CF/5x181WehfmAsF7 IIrbV4GshIxoqzF1eKv+sycB7tku0MRlj26I006lXe+us592K2aaKGJ5pnWKGJS8kjkKqqoqWYnY ADEC1fD/AOZ/meDzP581jWbck2txMEtidqxQosMbUPTkqcvpzp9Nj4MYiXVZpcUiXrv/ADidpUoH mHVmWkTfV7WF6dWHOSQV9gU+/Nf2pL6Q5OkGxKSf85V/8pppP/bNH/J+XLOzPoPvY6vmGPf847f+ TX0v/jFdf9Q75d2h/dH4MNL9b2D/AJyh0ya58gWt5GCVsL+N5vAJIjx1/wCDZR9Oa/s2VZK7w5Gq FwfMWinSxrFj+lldtL9eP68IzR/Q5D1OJ3341pm6ndGubgQqxfJ9S2//ADjj+VVzbxXFuLqWCZFk ilS5qrIwqrKQNwQc0Z7QyjbZ2P5eHcqf9C0/lj/vq8/6SD/zTg/lHL5L+Wh3O/6Fr/K/kV9O85AA kfWTWh6fs+2H+Ucvkv5aHcjdF/ID8vdG1ez1Wyjuhd2MyTwF5yy84zyWopvvkJ67JIEGt0xwRBsB 6RmG3MW81eSPJHnuzaPUoYrx7ZngS9t3AngkQ0dBIlaFW6o1RXqMvxZp4jtswnCMub5w/NP8iNX8 m2z6vYXH6S0FWAllI4Twcm4r6qj4WUkgc179QM3Gm1oyGjtJwcunMdxyYN5N8z3vljzNp+t2jlXt JVaVQdpIiaSRt7OlRmVmxicTEtOOfDK0/wDzf8gal5Q823Ecxkn06/drjT76QlzIjGrI7mtZIyaN Xc7N3yrSZxkh5hsz4zGXkknk/wA8eZfKOoG+0O7Nu7gLPCw5xSqK0EkZ2NK7HqO2WZcMcgqQYY8h idmT+b/z58/eaNKfSrmS3sbKZeF1HZRtGZl7q7O8rUPcKQD0O2U4tDjgbG582c9RKQpgWn6fe6jf QWFlC1xd3LrFBCgqzOxoAMypSAFlpAJNB9zeRfLa+WfKGlaEGDPZQKkzjo0rVeUj2MjNTOYz5OOZ l3u3hHhADw7/AJyy/wCOl5c/4w3X/Eo82fZfKTiazowX/nH/AP8AJu6D/wBHf/UFNmVr/wC5Pw+9 p0/1h9kZzrs3yx/zkN+WNzouuzeadOhLaNqknO64D+4un3fkOyyn4gf5qjwze6DUiUeE8w4GpxUe IPLfL/mPW/L2qRapo129nexfZkSlCD1V1NVZT3VhTM3JjjMVIWHGhMxNh6lH/wA5S+fltBE1jprz gU+sGOYE+5USha/hmD/JmO+Zcn83KuTzPzR5u8w+adTOpa5ePd3NOKVoqRp14RooCqPkPnvmbixR gKiHHnkMjZSfLGD7q/Lr/wAl95Y/7ZNj/wBQyZzGo/vJf1j97t8f0j3PnD/nJ3/yZMf/AGz4P+Jy ZuOzf7v4uFq/q+DyUV6jtme4r0/yv/zkV+YWhWUdjK9vq1vEOMTXyu0qqOg9VHRm/wBnU5hZez8c jfL3OTDUyHPdLfPH52+ePN9o1heTRWWmv/eWVkrRpJQ1HqMzO7fKtPbJ4dHDGbG5Y5NRKWzD9E0T VNc1S30vS7drq+um4Qwp1J7knoFA3JOwGZE5iIs8mqMTI0H2x+XXku28m+U7PRIWEk0YMl5OK0ku JN5GFe37K+wGc1qMxyTMna44cIp4J/zlX/ymmk/9s0f8n5c2vZn0H3uJq+YY9/zjt/5NfS/+MV1/ 1Dvl3aH90fgw0v1vrHzDoVhr2iXujX6lrS+iaGWn2hyGzLX9pTRh75occzCQkOjsJCxT4k87+Sta 8n69NpGqRkFSWtrgD93PFWiyIfA9x2OxzpcOaOSNh1WTGYmiyDyJ+d3nXyfaLp9tJFf6WhJjsrsM wjrufSdSrqPapX2yrPo4ZDZ2LPHqJR26Mr1D/nKjzjNbtHZaXY2krCnrt6kpXbqqllWvzrmPHsyA O5LadWegeYTeePN02vt5gfVrkayx3vFkKOAP2BxoAn+RTj7ZnDDDh4a2cfxZXd7vq78ldf8APuu+ Vv0j5sjiAlI/R0wj9KeaPflLKgogB24FVFRvToTodZDHGdQdjhlIxuSW/n/+YWueU/LkEGkQSR3G qs8J1QAFIFA+JVNdpWB+Go6VI3G09Dgjklv06Mc+QxGz5s8mfmH5r8nXz3Wi3hRZiDdWso9SCan8 6Hv/AJSkN75uc2nhkFSDgQyyjyZR56/PzzX5u0BtEmtrawtZipu2tvU5yhDXhVmNEJoSPbrlGDQw xy4ubbk1JkKYV5R8t3vmTzJp+iWaFpbyZUZlFeEdaySH2RAWOZOXIIRMj0accOKVPt7zN5W0LzNp Mmla1ardWcnxAHZkcdHjYbqwr1H6s5rHllA3F2sogii8I8wf84pXwnZ/L2tRPAalIdQVkdfAGWEO G+fAZtMfag/iHycSWk7illn/AM4qec3mAvdW06GH9p4TPMwHsrRQj/hsme04dAWI0h6l7F+XH5Ne VvI/+lQcr/WWUo+pTgAqDswhjFRGD8y3vTNdqNXLLtyHc5WPCIcme5itrzz81Pygg8/3GnTS6o+n nT0lQKsIl5+qVNd3SlOGZml1fhA7XbTlwiaR+Qv+cebXyj5ssfMMeuSXj2Xq0tmtxGG9WF4ftCRq U9SvTLM+vOSBjVWxx6cRN29fzXuQpXVpa3dtLa3cKXFtOpSaCVQ6OjChVlaoIOEEg2FeJ+bP+cXN CvZ5Lny5qL6WXPL6lOpnhBPZHqsiD58s2WLtKQ2kLcWelB5bMYtP+cUfMjT8bvXLOG3r/eRRyyvT x4N6Q/4bLz2pHoC1/lD3vRdM/wCcevKGm+WdQ0u3keTVNRhMEmszoskkYJBPpR1VUG3Y18TmHLXz Mgeg6N8cEQCO9in/AEKZY/8AUyy/9Ii/9Vcv/lQ/zfta/wAoO97f5e0ldG0DTNIWUzLptpBaCYji XEEax8uNTSvGtK5rck+KRPeXKiKFPl7/AJyd/wDJkx/9s+D/AInJm77N/u/i4Gr+r4LP+cbtH0vW fOOrabqltHeWNxo8yywSiqkfWbffxBHUEbjtj2hMxgCOfF+go0oBkb7ma+Zf+cVLSW4eby5rBtoW 3WzvUMgU+0yEGnhVCffMbH2ma9QbpaQdClWmf84oa28w/Seu20MNfi+rRSTMR7c/RAyyXakegYjS d5ez+Qvyw8qeSbZl0m3L3sq8bjUZ6PcSDrx5AAKtR9lQB41Oa7PqZ5DvycnHiEeTLMx2x5p+aP5K W/n3WLXUpdWfT2tbcWwiWAShgHZ+VS6U+3mbptYcQIq2nLhE0v8Ay+/5x+tfJ3mm11+PW3vWtllU W7W4jB9WNo/tCRunKvTJ59eckeGqRj04ibt63mvb0m81eT/LnmrTjp+uWSXcAqYmNVkjYinKN1oy n5de+WYs0oG4ljKAkKLxXW/+cUEMzPoevFISfgt72LkwHvLGRX/kXmyh2p/ODiy0g6FKLb/nFLzS z0udasYk/mjWaQ/cyx/ryw9qQ6Asfyh73oPkz/nHDyZoNzHe6nJJrt5EQyC4VY7YMNw3oAty+Tuw 9sxM3aE5ih6Q3Y9PGO/N6yAAKDpmA5CD1jRtK1nTptN1W1jvLG4XjLBKKqfAjuCDuCNwemShMxNj YoIB2Lw7zJ/zipZy3DzeXdYNrCxqtneRmQLXrSZCDTwBQn3zZ4+0zXqDiy0g6FJrD/nFHzC8oF/r tpBFXdoI5Zmp8n9Efjlsu1I9AWI0nm9l/L38q/K/ka2f9GxtPqE6hbnUZ6GVx14rQAIld+I+kmma 3UaqWU78nJx4hDkzHMdsdirsVdirsVdirsVdirsVdirsVdirsVdir5P/AOcnf/Jkx/8AbPg/4nJm +7N/u/i6/V/V8ET/AM4r/wDkwdQ/7ZM3/UTb5HtP+7H9b9BXSfV8H1Pmjdg7FXYq7FXYq7FXYq7F XYq7FXYq7FXYq7FXYq7FXYq7FXYq7FUl0bzXp2ra3rWj20cyXOhSQxXbyKojZp0Mi+mQzEgAb1Ay yeIxiCf4mIlZI7k6ytk7FXYq7FXYq7FXYq7FXYqw3zb+UfkfzZqo1TW7SSe8ESwh0mljHBCSBxRg P2jmTi1c8YqJ2a54oyNlf5P/ACo8leUNTl1LQrSSC7mha2d3mkkBjZ1cijkj7UYwZdVPIKkVhijE 2GX5jtiT6J5jXVdS1exFhd2h0idbcz3MfCOfkvLnC1fiX+FD3yyePhANjdANpxlaXYq7FXYq7FXY q7FXYq7FXYqkug+bNO1rUtZ0+1jmSbRLgWt20qqFZyvKsZVmJWniBlk8RiAT/ExErvyTrK2TsVdi ry6PUPO35ga1qiaJq58u+VNJuXsUvLeNZLu8uIqeoVZ9kjUnYjr7/s53DDFEcQ4pnfyDTcpHY0E7 8saN+Y+ia+tnf6vH5h8tTRMxvLlRDe28q04oOAIlV69/wpRqsk8co2Bwy+xlESB52GbZjNjsVeJa Xp3nPVfzU886foeqDRNNM9pJqWopEstwSLekUMPP4V5fEWbqKDNnKUI4oGQ4jvTjjiMyBsGT+UNS 80aJ5/uvJWu6m2tWs9gNT0jUZkVJ1VZBFJDJwFG3qQT4e9BRljGWMTiK3os4kiVHd6NmG2uxV43q vni78x+b9Y0oecbTyboOiTGzJaS2S+u7iM0lKmdgUjRgRVevv+zsY4RCAPCZyl8g45yWSLoBFeUP PV5pvnez8q3fmiz83aXq0Uh03U4Hga5gnhXkYbgQMwIZfss25ORy4BKBmImBHMJhk9VXdvWswG92 KvKL6/8AzC1v80fMHlbSdX/Rei2sFnPNeiFJZYA0NTFAG25Ts9SzVoF28DnxjjjijMizu0kyMiAd kFBe/mpZ+cJvy5i1pbs3ECalB5mnhRrm2satHIvpfYkcygIpPT7uMiMRh4leVebG5cXDfxTvy/d+ a/LH5gWvlXWdZfXtM1q0ludPurhES4hntjWWMlPtIU33+joa15BCePjiOEgswSJUTb0nMJtdirCf IOu6tqXmbznaXtw01vpuorBYxkKBHGY68RQAnfxzJzwAjAjqGESSSzbMZmoahfW2n2Fzf3TcLa0i eed+tEjUux+4YYxJNBSXmGhWP5kefbBPMVz5il8saXe1k0nSrCJGkFuT8Ek8z7szjenTvt0zOnLH iPCI8RHMlpjxS3umW+SrXz9YyX1h5ou7fVLWAp+jNWjUQzzKQeQmhUcFK7bg/f1zHzHGaMRXeGcB Ic2U5Qzad1RGdyFRQSzHoANycVeU6JJ5+/MaGXXrTXpPLHlmSV49HtbWGN7mdImKGeaR91qyn4R/ ac+fh4fSRxS6tMTKe90HaJqv5kab+ammeV/MOpJf6c9jczw3kUSw/WlX7LSoAQskZFCFNKUxnHGc RlEUb+SxMhKj3PV8wG52KvOvyw/5TD8wv+2sn/JrMzU/RD+q1w5n3/oei5htiX+Yb29sdA1O9sIf rN9a2k81pb0J9SWONmjSg3PJgBtk8YBkAeVokdnn35XS+atZGn+YE86x63p9zFXW9Jkto1aC4ZK+ nGYyrRlG2+IUIFd6imXqRCNx4OE9C1Y7O92htJ1PUvyx1TVtM1XTLu98q395Lf6VqthC1x6BuGBe 3uFXdeJ+ye/6pSiM4BBAkBRBUEwJB5Mk8teftX8zeYFj0zQbmDyxFE/1nWL9Wtneb9hbeJgS6/zE 0+ilGoyYBCO59XcGUZknlszbMZsdirA/Ium6jbefvPt1c2s0FteXNk1pPJGyRzKluVYxsQA4U7Gm ZWeQOOAB5AtcB6i6803UW/O3T9RW1mOnpoUsD3gjYwiU3PIRmSnENTela4iQ8Ai9+JSPX8GeZitj sVeK/o6w8kea9dXzH5X/AEx5c1i8k1HT9ZgsUvGt3nNZYJhxZ1RT9n8K1NNlxHLAcMqkBVXTjgcJ NjYp35RlGueboL7RvJ9tovlayictqN7YR293cXDbRm2AAZFT+buKjY0yvKOGFSlcj3Hb4s4mzsNn p+YLa7FWF+WNPv4fzM873k1tLHaXceki1uXRljlMUEok9NyOLcCQGp0zJySBxQH9ZriPUfg5NPv/ APlc0uofVpfqB8uR24u+Dej6wvncx+pTjz4nlxrWmPEPBrrxfoWvX8EP5k03UZvzc8nX8VrNJY2t tqK3N0kbNFG0kQCB3A4qWPSp3w45DwZC97CyHqHxZ5mK2OxVgX5dabqNp5q88z3VrNbw3eppJaSy xsiyoI6co2YAOte4zK1EgYQo9GuA3PvZ7mK2IPWdMg1XR77S5yVgv7eW1lZeoSZCjEV9myUJcJB7 kEWKeY+VvPmoeSNIg8r+c9Jvkn0pPq1jqllA9za3VvEKRFWTdW4gLxI+dMzcuAZTxQI36dzTCRiK I5Mx8leadf8AMct9d3Why6RooKDSnvKx3cwoebvBvxXpxNfvzHzYowoA3Lr3NkJE9KZTlDNbLEks TxOKpIpVh02IocQVeSeVfMOp/lrYHyl5i0i/utOspJP0NrWnwNcxTQSyF1SUJukoZ6U/222GXGMx 44kWeYLRAmGxXaTqHmvzF+buka5caDe6X5egsLqKxe6iZXq1OTzgVWJpDQKjGtBXvjKMIYTEEGVh IJM7ranrea9udirAPy3sr2382efJbi3khiuNUR7d5EZVkX0qckJFGHuMy9QQYQ9zXAbn3s/zEbEH rF7dWOlXd5aWb6hc28TSQ2URVXlZRUIpbYV/zrkoAEgE0gvItIuINf8AzM0XWfKmg3+gzxiY+bbi 4t2tYHjZKiGVPsySl/2qV6Henw7CY4MRjMiX81pG8gQK73//2Q== xmp.iid:915E11122D206811822AB5765E764826 xmp.did:915E11122D206811822AB5765E764826 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf xmp.iid:905E11122D206811822AB5765E764826 xmp.did:905E11122D206811822AB5765E764826 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:905E11122D206811822AB5765E764826 2015-06-03T14:12:38+01:00 Adobe Illustrator CS6 (Macintosh) / saved xmp.iid:915E11122D206811822AB5765E764826 2015-06-03T14:12:58+01:00 Adobe Illustrator CS6 (Macintosh) / Print Adobe PDF library 10.01 }ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw $}ICC_PROFILE{od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B}ICC_PROFILE3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQ}ICC_PROFILEDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKl}ICC_PROFILELnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 }ICC_PROFILE E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ }ICC_PROFILE K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:}ICC_PROFILE 7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_ki}ICC_PROFILE kvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht}ICC_PROFILE ! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: }ICC_PROFILEuGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhw}ICC_PROFILEgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=}ICC_PROFILEN=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7